View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2562_low_29 (Length: 360)
Name: NF2562_low_29
Description: NF2562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2562_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 202 - 345
Target Start/End: Complemental strand, 13199229 - 13199086
Alignment:
| Q |
202 |
cttatttaatacatattgtcttatattttatgcaaactactttgccacaaatggtaaattagtaatctagagaaatcgacaatcttctccacattatgtg |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13199229 |
cttatttaatacatattgtcttatattttatgcaaactactttgccacaaatggtaaattagtaatctagagaaatcgacaatcttctccacattatgtg |
13199130 |
T |
 |
| Q |
302 |
attgtgaagtaagtagctatgacgattattgatttgatggcgtt |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13199129 |
attgtgaagtaagtagctatgacgattattgatttgatggcgtt |
13199086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 15 - 71
Target Start/End: Complemental strand, 13199420 - 13199364
Alignment:
| Q |
15 |
atgaacttaaaccgaccattatgtactaaaactaaaatgaatttttcttcaaaatga |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13199420 |
atgaacttaaaccgaccattatgtactaaaactaaaatgaatttttcttcaaaatga |
13199364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University