View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2562_low_32 (Length: 346)
Name: NF2562_low_32
Description: NF2562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2562_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 34185706 - 34185455
Alignment:
| Q |
1 |
acataaacaatatcatcgacacaatcccataaattgggcagaaaattttgcaagtatttgtca---gtttatgtttgttttcttacaagatttatctaga |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34185706 |
acataaacaatatcatcgacacaatcccataaattgggcagaaaattttgcaagtatttgtcataagtttatgtttgttttcttacaagatttatctaga |
34185607 |
T |
 |
| Q |
98 |
tatgttatattaacccctctcttgtcaaacatatagacccaaaatagatcattttcattggagaatggtgatagatatctttttgcatacaataaaattg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34185606 |
tatgttatattaacccctctcttgtcaaacatatagacccaaaatagatcattttcattggagaatggtgatagatatctttttgcatacaataaaattg |
34185507 |
T |
 |
| Q |
198 |
tgaaaactcatttgaaatatccacgatttgtcacctcacctcccttcttcat |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34185506 |
tgaaaactcatttgaaatatccacgatttgtcacctcacctcccttcttcat |
34185455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University