View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2562_low_36 (Length: 330)
Name: NF2562_low_36
Description: NF2562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2562_low_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 1e-72; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 136 - 312
Target Start/End: Original strand, 36776672 - 36776849
Alignment:
| Q |
136 |
tgaattaccttcaatgttatcaccagatggattagaaccagcattcttgaaaacttgtctattttctggcatctgaatagcgttgaaatagaaagat-nn |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36776672 |
tgaattaccttcaatgttatcaccagatggattagaaccagcattcttgaaaacttgtctattttctggcatctgaatagcgttgaaatagaaagataaa |
36776771 |
T |
|
| Q |
235 |
nnnnnnnttagttttcgatcaaaccttgatgaccctttaagcttttaggatgaaatcagttaagaacactgaaattaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36776772 |
aaaataaatagttttcgatcaaaccttgatgaccctttaagcttttaggatgaaatcagttaagaacactgaaattaa |
36776849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University