View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2562_low_45 (Length: 281)
Name: NF2562_low_45
Description: NF2562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2562_low_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 53 - 271
Target Start/End: Complemental strand, 35290129 - 35289911
Alignment:
| Q |
53 |
tttataactctaatcaaattttatctttattatatgcaagacttgagtgtttttaataaatttctctaattatatgattaaatttaatgatgagagaatt |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35290129 |
tttataactctaatcaaattttatctttattatatgcaagacttgagtgtttttaataaatttctctaattatatgattaaatttaatgatgagagaatt |
35290030 |
T |
 |
| Q |
153 |
agatgaattttatttattttctctaaatttaattgctagttctattttttagttatatatatcaattccaaaaaagcaagtacaaaatacaaataccaaa |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35290029 |
agatgaattttatttattttctctaaatttaattgctaattctattttttagttatatatatccattccaaaaaagcaagtacaaaatacaaataccaaa |
35289930 |
T |
 |
| Q |
253 |
tataaactatagtcctatg |
271 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
35289929 |
tataaactatagtcttatg |
35289911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University