View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2562_low_47 (Length: 276)
Name: NF2562_low_47
Description: NF2562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2562_low_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 5e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 93 - 226
Target Start/End: Complemental strand, 30248932 - 30248799
Alignment:
| Q |
93 |
ctgcatgaatttgtaatgctaaaattttaatttgctttgatttgaataaaattgcataagtaatagactttgaaagtaaatatgtaagttaacataaatg |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30248932 |
ctgcatgaatttgtaatgctaaaattttaatttgctttgatttgaataaaattgcataagtaatagactttgaaagtaaatctgtaagttaacataaatg |
30248833 |
T |
 |
| Q |
193 |
aaagaaactgcatgaattgctatttcgacatgaa |
226 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
30248832 |
aaagaaactgcatgaattgctatttcggcatgaa |
30248799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University