View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2562_low_53 (Length: 255)
Name: NF2562_low_53
Description: NF2562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2562_low_53 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 232
Target Start/End: Original strand, 9234399 - 9234612
Alignment:
| Q |
19 |
aacaaccacttcaataatagttgcttcaataacactaatcacattcaaaactccaatgaggacttgtttgggtttggaaatcacgggcaaggagaaaact |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9234399 |
aacaaccacttcaataatagttgcttcaataacactaatcacattcaaaactccaatgaggacttgtttgggtttggaaatcatgggcaaggagaaaact |
9234498 |
T |
|
| Q |
119 |
taagaatgggagaatgggatttggagggtttgatgcaagacatatcctattttcctcctctcgatttccaagtttaattgtcttttcattcttttgaatt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | |||||||||| |||||||| |
|
|
| T |
9234499 |
taagaatgggagaatgggatttggagggtttgatgcaagacatatcctattttcctcctcttgatttccaagtttaatggccttttcattcctttgaatt |
9234598 |
T |
|
| Q |
219 |
tccaatcacccctt |
232 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
9234599 |
tccaatcacccctt |
9234612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University