View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2562_low_55 (Length: 252)
Name: NF2562_low_55
Description: NF2562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2562_low_55 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 2 - 195
Target Start/End: Original strand, 26416221 - 26416414
Alignment:
| Q |
2 |
ccgaggtagcaattatgttcttatgaagtaatttaattaatacatattcaatttttctcatgcagtcaggacaaatacaattgtgtaacacaaagatgaa |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26416221 |
ccgaggtagcaattatgttcttatgaagtaatttaattaatacatattcaatttttctcatgcagtcaggacaaatacaattgtgtaacacaaagatgaa |
26416320 |
T |
 |
| Q |
102 |
tatgaaaacacaagaatcaaaaagagagtaccctttacctgaaaaatcatctcttggtcatttaagcttagaccttgagcttaatttgacatgt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26416321 |
tatgaaaacacaagaatcaaaaagagagtaccctttacctgaaaaatcatctcttggtcatttaagcttagaccttgagcttaatttgacatgt |
26416414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University