View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2562_low_56 (Length: 251)
Name: NF2562_low_56
Description: NF2562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2562_low_56 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 16 - 202
Target Start/End: Complemental strand, 32915335 - 32915144
Alignment:
| Q |
16 |
ataatgcaagtatgagaaaaaattgattgtttattgtccattggattatgtatttataacaccatgactaccatgttttgcagccaaaaactcctttagt |
115 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32915335 |
ataatgcaagtaagagaaaaaattgattgtttattgtccattggattatgtatttataacaccatgactaccatgttttgcggccaaaaactcctttagt |
32915236 |
T |
|
| Q |
116 |
tggctatgatgcatttcgctatcccttcttgacaaattccttctggacgtatag-----cacttgttgaaatatcatttatcattaaataaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |||||||||||||||||||||||| |
|
|
| T |
32915235 |
tggctatgatgcatttcgctatcccttcttgacaaattccttctggacgtatagtaccactcttgttcaaatatcatttatcattaaataaa |
32915144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 194 - 251
Target Start/End: Complemental strand, 32914959 - 32914902
Alignment:
| Q |
194 |
ttaaataaatgtagacattacaagatggaccaacaaaattccatagactactgctttc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32914959 |
ttaaataaatgtagacattacaagatggaccaacaaaattccatagactactgctttc |
32914902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University