View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2562_low_65 (Length: 239)

Name: NF2562_low_65
Description: NF2562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2562_low_65
NF2562_low_65
[»] chr6 (1 HSPs)
chr6 (1-222)||(34431618-34431840)


Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 34431840 - 34431618
Alignment:
1 ttcatctgattaaatcgcattagttatgagtaatttggattcaatacaaaaattaacttaatcgagtgttt-aatcggtttatagtttctgttaatttga 99  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
34431840 ttcatctgattaaatcgcattagttatgagtaatttggattcaatacaaaaattaacttaatcgagtgttttaatcggtttatagtttctgttaatttga 34431741  T
100 tttatgtgtttttgttttgattcagtcgaagaaaagaggactttcgttggaagagaagcgagagaagatgcttcagatcttttacgaatcacaagatttc 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34431740 tttatgtgtttttgttttgattcagtcgaagaaaagaggactttcgttggaagagaagcgagagaagatgcttcagatcttttacgaatcacaagatttc 34431641  T
200 tttctggttagttacttccttcc 222  Q
    |||||||||||||||||||||||    
34431640 tttctggttagttacttccttcc 34431618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University