View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2562_low_66 (Length: 239)
Name: NF2562_low_66
Description: NF2562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2562_low_66 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 18 - 173
Target Start/End: Original strand, 14513535 - 14513692
Alignment:
| Q |
18 |
atgaaaaggtttatgtgtctttttcattggttttgttcttcaccttggatatttttgagaatggaataaaaatctgaacatgtctttttcttgtgt--gt |
115 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
14513535 |
atgagaaggtttatgtgtctttttcattggttttgttcttcaccttggatatttttgagaatggaataaaaatctgaacatgtctttttcttgtgttgat |
14513634 |
T |
 |
| Q |
116 |
gatttttgatgtatagaatctatacccttctctcacttgggtactattatcttcctcc |
173 |
Q |
| |
|
| |||||| |||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
14513635 |
ggtttttggtgtatataatctatacccttttctcacttgggtactattatcttcctcc |
14513692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University