View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2562_low_76 (Length: 217)
Name: NF2562_low_76
Description: NF2562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2562_low_76 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 147
Target Start/End: Complemental strand, 30248760 - 30248612
Alignment:
| Q |
1 |
agctatttcaatcattaattttaccaaacagtaaaaattgattcagttagcata--tgctattgagtgatgattaccggaactttttaacatatggacat |
98 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30248760 |
agctatttaaatcattaattttaccaaacagtaaaaattgattcagttagcataaatgctattgagtgatgattaccggaactttttaacatatggacat |
30248661 |
T |
|
| Q |
99 |
taaattgttttgtttttaatgtaatacatcaatttaaatgaaataatac |
147 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30248660 |
gaaattgtgttgtttttaatgtaatacatcaatttaaatgaaataatac |
30248612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 156 - 199
Target Start/End: Complemental strand, 30248588 - 30248545
Alignment:
| Q |
156 |
aggtacttctaattttcatatacttcaggataataattcacatt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30248588 |
aggtacttctaattttcatatacttcaggataataattgacatt |
30248545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University