View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2562_low_77 (Length: 214)

Name: NF2562_low_77
Description: NF2562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2562_low_77
NF2562_low_77
[»] chr8 (1 HSPs)
chr8 (12-196)||(40420438-40420620)


Alignment Details
Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 12 - 196
Target Start/End: Original strand, 40420438 - 40420620
Alignment:
12 tgagatgaaggagatggatgtgaatcaaattattaagcaggaaaaatagttatactgcagaatnnnnnnnnntgttatgagtattaatcagagaaattta 111  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||         |||||||||||||| |   |||||||||    
40420438 tgagatgaaggagatggatgtgaatcaaattattaagcgggaaaaatagttataccgcagaataaaaaaa--tgttatgagtattactataagaaattta 40420535  T
112 aagatggtcaactgttaactaggaaaataatggtacagaaggctacgactattttgatttgactgccacgcaaaaggctagggat 196  Q
    ||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||    
40420536 aagatagtcaactgttaactaggcaaataatggtacagaaggctacgactattttgatttgactgccacggcaaaggctagggat 40420620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University