View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2563_high_7 (Length: 457)
Name: NF2563_high_7
Description: NF2563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2563_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 397; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 397; E-Value: 0
Query Start/End: Original strand, 22 - 447
Target Start/End: Complemental strand, 6367135 - 6366710
Alignment:
| Q |
22 |
tagatgttgttgcggtgtttgatcttcttggagattgaaggctgagagaggaaacgacctagcaatcccagaggaattggcaaacaagatcttattggaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6367135 |
tagatgttgttgcggtgtttgatcttcttggagattgaaggctgagagaggaaacgacctagcaatcccagaggaattggcaaacaagatcttattggaa |
6367036 |
T |
 |
| Q |
122 |
gaaggatcatcgatgaagattgtcgataccgggagccatacaaacaactctttggtcttaacaccggtgatccttcgcataacatgttcctccacgaagg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6367035 |
gaaggatcatcgatgaagattgtcgataccgggagccatacaaacaactctttggtcttaacaccggtgatccttcgcataacatgttcctccacgaagg |
6366936 |
T |
 |
| Q |
222 |
ccgtgacctctgtatcaaaggaaaccgtgcgaccaatggcattgaaccggtgcaccnnnnnnngtctttgcctgagccacacgaaacctgtgacacggtt |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6366935 |
ccgtgacctctgtatcaaaggaaaccgtgcgaccgatggcattgaaccggtgcacctttttttgtctttgcctgagccacacgaaacctgtgacacggtt |
6366836 |
T |
 |
| Q |
322 |
gatacccatttccacaatgttgtccaaaggaagcaatcctcttggaagcaacatttcgtctaggagaagccgtgatttttgcttgcatattgcttccccc |
421 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6366835 |
gatacccatttccacaatgttgtccaaaggaagcaatcctcttggaagcaacatttcgtctaggagaagccgtgatttttgcttgcatattgcttccccc |
6366736 |
T |
 |
| Q |
422 |
ttgaatatctctgcctcgttcctttg |
447 |
Q |
| |
|
||||||||||||||||| |||||||| |
|
|
| T |
6366735 |
ttgaatatctctgcctcattcctttg |
6366710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University