View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2563_low_14 (Length: 347)
Name: NF2563_low_14
Description: NF2563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2563_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 13 - 337
Target Start/End: Complemental strand, 54154247 - 54153923
Alignment:
| Q |
13 |
gtgggaattggacaggtgaggagattcaaaggataatttctgtttgttttcttcttttgtttatgagtcaaccttgactcttcttcgtccgatttattga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54154247 |
gtgggaattggacaggtgaggagattcaaaggataatttctgtttgttttcttcttttgtttatgagtcaaccttgactcttcttcgtccgatttattga |
54154148 |
T |
 |
| Q |
113 |
atctactccttttccgactaggcaaattggatttgcgattcttttcgattatcattgttgaataaaggaatcaaaaatcaaattaggcattaatcaaatg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54154147 |
atctactccttttccgactaggcaaattggatttgcgattcttttcgattatcattgttgaaaaaaggaatcaaaaatcaaattaggcattaatcaaatg |
54154048 |
T |
 |
| Q |
213 |
tcggattctcatctccatgggtttcttctctcttttttcttatgggtttctcagtcacctataaattaaaattagaaacaggaaatccaaatccattttt |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54154047 |
tcggattctcatctccatgggtttcttctctcttttttcttatgggtttctcagtcacctataaattaaaattagaaacaggaaatccaaatccattttt |
54153948 |
T |
 |
| Q |
313 |
taatgtgattttcatcgcccctttg |
337 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
54153947 |
taatgtgattttcatcgcccctttg |
54153923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University