View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2563_low_23 (Length: 252)
Name: NF2563_low_23
Description: NF2563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2563_low_23 |
 |  |
|
| [»] scaffold0137 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 78; Significance: 2e-36; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 16 - 97
Target Start/End: Original strand, 46283490 - 46283571
Alignment:
| Q |
16 |
aggtatatggctgagtttaagattggtgatgagaaaaaatctgctgctgaggatactatgttgtcttacaaagctgcacagg |
97 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46283490 |
aggtatttggctgagtttaagattggtgatgagaaaaaatctgctgctgaggatactatgttgtcttacaaagctgcacagg |
46283571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 182 - 252
Target Start/End: Original strand, 46283656 - 46283726
Alignment:
| Q |
182 |
ctgctgcggatcttccatcaactcatcctataagattgggtttggctctcaatttctctgttttctattac |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46283656 |
ctgctgcggatcttccatcaactcatcctataagattgggtttggctctcaatttctctgttttctattac |
46283726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 13 - 97
Target Start/End: Complemental strand, 3898797 - 3898713
Alignment:
| Q |
13 |
caaaggtatatggctgagtttaagattggtgatgagaaaaaatctgctgctgaggatactatgttgtcttacaaagctgcacagg |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| ||| ||||||||||| |||||||||| |
|
|
| T |
3898797 |
caaaggtatatggctgagtttaagattggtgatgacaaaaaatctgctgttgaggatattatcttgtcttacaaggctgcacagg |
3898713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 190 - 251
Target Start/End: Complemental strand, 3897265 - 3897204
Alignment:
| Q |
190 |
gatcttccatcaactcatcctataagattgggtttggctctcaatttctctgttttctatta |
251 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||| | |||||||| ||||||||||| |
|
|
| T |
3897265 |
gatcttcgatcttctcatcctataagattgggtttggctttgaatttctcggttttctatta |
3897204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0137 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: scaffold0137
Description:
Target: scaffold0137; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 13 - 97
Target Start/End: Complemental strand, 5128 - 5044
Alignment:
| Q |
13 |
caaaggtatatggctgagtttaagattggtgatgagaaaaaatctgctgctgaggatactatgttgtcttacaaagctgcacagg |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| ||| ||||||||||| |||||||||| |
|
|
| T |
5128 |
caaaggtatatggctgagtttaagattggtgatgacaaaaaatctgctgttgaggatattatcttgtcttacaaggctgcacagg |
5044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0137; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 182 - 251
Target Start/End: Complemental strand, 4929 - 4860
Alignment:
| Q |
182 |
ctgctgcggatcttccatcaactcatcctataagattgggtttggctctcaatttctctgttttctatta |
251 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||||| | |||||||| ||||||||||| |
|
|
| T |
4929 |
ctgctgcggatcttcgatcttctcatcctataagattgggtttggctttgaatttctcggttttctatta |
4860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University