View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2563_low_25 (Length: 250)
Name: NF2563_low_25
Description: NF2563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2563_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 7 - 140
Target Start/End: Original strand, 25949158 - 25949291
Alignment:
| Q |
7 |
tcctgcaggcaaagaaactagttgtttcgtcgttttattttagcatgtctgcaactaatatcgtgtctcttctgtaataataatttttccttttgaggtg |
106 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25949158 |
tcctgcaggcatagaaactagttgtttcgtcgttttattttagcatgtctgcaactaatatcgtgtctcttctgtaataataatttttccttttgaggtg |
25949257 |
T |
 |
| Q |
107 |
atgattttaatgatgcgggtgtttgaaggaggaa |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
25949258 |
atgattttaatgatgcgggtgtttgaaggaggaa |
25949291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 143 - 210
Target Start/End: Original strand, 25949337 - 25949404
Alignment:
| Q |
143 |
agatgattaaactacttgcagaagtgtgggagcgcttattaccagcaaatggttcatgttctcatgga |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25949337 |
agatgattaaactacttgcagaagtgtgggagcacttattaccagcaaatggttcatgttctcatgga |
25949404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 131
Target Start/End: Original strand, 25952885 - 25953013
Alignment:
| Q |
1 |
aagatgtcctgcaggcaaagaaactagttgtttcgtcgttttattttagcatgtctgcaactaatatcgtgtctcttctgtaataataatttttcctttt |
100 |
Q |
| |
|
||||||||||||| || | ||||| ||||||||||||||||||||||||| || |||| |||||||||||||||| ||| |||||||||||| |||| |
|
|
| T |
25952885 |
aagatgtcctgcaagcttataaactggttgtttcgtcgttttattttagcaagtatgcatctaatatcgtgtctct--tgttctaataatttttcttttt |
25952982 |
T |
 |
| Q |
101 |
gaggtgatgattttaatgatgcgggtgtttg |
131 |
Q |
| |
|
|||||||| ||||||||||||||||||| |
|
|
| T |
25952983 |
cccgtgatgatcttaatgatgcgggtgtttg |
25953013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University