View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2565_low_13 (Length: 220)
Name: NF2565_low_13
Description: NF2565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2565_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 204
Target Start/End: Complemental strand, 37532126 - 37531940
Alignment:
| Q |
18 |
acaatgatagttggggcttctattaaatttagaggtgataatagagagtttaaggctgcaaagatgtgctggaagccatggaggttcgaggtttgggcag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37532126 |
acaatgatagttggggcttctattaaatttagaggtgataatagagagtttaaggctgcaaagatgtgctggaagccatggaggttcgaggtttgggcag |
37532027 |
T |
|
| Q |
118 |
gtgccatggggctgctcacgactcttcaatggcccaagagttttaatctcgatcggattgattatgtttgaagttgatacacaggtt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37532026 |
gtgccatggggctgctcacgactcttcaatggcccaagagttttaatctcgatcggattgattatgtttgaagttgatacacaggtt |
37531940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University