View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2565_low_7 (Length: 290)
Name: NF2565_low_7
Description: NF2565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2565_low_7 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 290
Target Start/End: Complemental strand, 48091290 - 48090988
Alignment:
| Q |
1 |
ctgtaagtagaggaatgaggaaaggtgctatatatata--gtgtgtcagagatattaatatgtatatgatgattttggaaaataatattgatggaagaat |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48091290 |
ctgtaagtagaggaatgaggaaaggtgctatatatatatagtgtgtcagagatattaatatgtatatgatgattttggaaaataatattgatggaagaat |
48091191 |
T |
 |
| Q |
99 |
ggcccacacaacaaaaggtagta-----------gttgcattttattcatacat----tggaaaataaaatttaaggtgtggactgtcatgcatatatac |
183 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
48091190 |
ggcccacacaacaaaaggtagtacacaggtagtagttgcattttattcatacatacattggaaaataaaatttaaggtgtggactgtcatgcata----c |
48091095 |
T |
 |
| Q |
184 |
attgcatatatagtaagatgcatgttaaagtaccctcttttgcactctgtagtattactttaccgaccaataaggaagaataaatataactgccaattct |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48091094 |
attgcatatatagtaagatgcatgttaaagtaccctcttttgcactctgtagtattactttaccgaccaataaggaagaataaatataactgccaattct |
48090995 |
T |
 |
| Q |
284 |
tcattcc |
290 |
Q |
| |
|
||||||| |
|
|
| T |
48090994 |
tcattcc |
48090988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University