View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2565_low_8 (Length: 281)
Name: NF2565_low_8
Description: NF2565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2565_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 25698183 - 25697980
Alignment:
| Q |
1 |
aagcaaaaacacggttttctctgacatagagtgtgaggcagacgtgtctctacgaggaacaccaacgttgtcattgttgttttgatctattgcttgtttg |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| ||||||||| | ||||||||||||||||| ||||||||||||||||||||||| ||| |
|
|
| T |
25698183 |
aagcaaaaacacagttttctctgacatagagtgtgaggcagaggtgtctctaaggggaacaccaacgttgtccttgttgttttgatctattgcttgcttg |
25698084 |
T |
|
| Q |
101 |
gattttgagaacaaaggatt---gctgataggaagaactttttctctgagctttgaaagtttaccaacccatacttctgcaattgcacccatttttctta |
197 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||||||| |
|
|
| T |
25698083 |
gattttgagaacaaaggattgctgctgataggaagaactttttctctgagctttgaaagtttaccaacccatgcctctacaattgcacccatttttctta |
25697984 |
T |
|
| Q |
198 |
gcac |
201 |
Q |
| |
|
|||| |
|
|
| T |
25697983 |
gcac |
25697980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 39 - 152
Target Start/End: Complemental strand, 25681533 - 25681417
Alignment:
| Q |
39 |
cagacgtgtctctacgaggaacaccaacgttgtcattgttgttttgatctattgcttgtttggattttgagaacaaaggattgct---gataggaagaac |
135 |
Q |
| |
|
|||| |||||||| | |||||||||||||| | ||||||||||||||| | | ||||||| |||||| | |||||| ||||| | | |||||||| |
|
|
| T |
25681533 |
cagaggtgtctcttggtggaacaccaacgttcttcttgttgttttgatctgctccatgtttggcttttgaaagcaaaggcttgctcttgttgggaagaac |
25681434 |
T |
|
| Q |
136 |
tttttctctgagctttg |
152 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
25681433 |
tttttctctgagctttg |
25681417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University