View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2566_high_18 (Length: 278)
Name: NF2566_high_18
Description: NF2566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2566_high_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 102 - 265
Target Start/End: Original strand, 25246939 - 25247102
Alignment:
| Q |
102 |
gacattatttaatatgaaaatgaaagaaaatgacactgaactcttcctcatacactcatttgatatccaaattgaaacaccataattttttattaacctt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25246939 |
gacattatttaatatgaaaatgaaagaaaatgacactgaactcttcctcatacactcatttgatatccaaattgaaacaccataattttttattaacctt |
25247038 |
T |
 |
| Q |
202 |
gcggttgaattatattggcatatagagtatgttattacaagtacaacgtgtaattgatctatat |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25247039 |
gcggttgaattatattggcatatagagtatgttattacaagtacaacgtgtaattaatctatat |
25247102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University