View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2566_high_27 (Length: 244)
Name: NF2566_high_27
Description: NF2566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2566_high_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 35228147 - 35228045
Alignment:
| Q |
1 |
actaaatgtggtgagaaaggatatatcaagattaagagagacgtgcatgccaaggaaggttcatgtggaattgctatggttcccacttatccaattgttt |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35228147 |
actaaatggggtgagaaaggatatatcaagattaagagagacgtgcatgccaaggaaggttcatgtggaattgctatggttcccacttatccaattgttt |
35228048 |
T |
|
| Q |
101 |
aag |
103 |
Q |
| |
|
||| |
|
|
| T |
35228047 |
aag |
35228045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 143 - 226
Target Start/End: Complemental strand, 35228046 - 35227963
Alignment:
| Q |
143 |
agtcttcttatactagtttgatgaattgcttgtgtttgaattagttatgtgtgtgagtgtttgaataaatagctagggtgtgta |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35228046 |
agtcttcttatactagtttgatgaattgcttgtgtttgaattagttatgtgtgtgagtgtttgaataaatagctagggtgtgta |
35227963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University