View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2566_low_2 (Length: 682)
Name: NF2566_low_2
Description: NF2566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2566_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 4e-40; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 4e-40
Query Start/End: Original strand, 17 - 101
Target Start/End: Original strand, 2479991 - 2480075
Alignment:
| Q |
17 |
aacacataatgaggttgacgttctcacattggtatttctaaagaaaggtatgaacactttgtatcctttcttcaacaataaattg |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2479991 |
aacacataatgaggttgacgttctcacattggtatttctaaagaaaggtatgaacactttgtatcctttcttcaacaataaattg |
2480075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 235 - 364
Target Start/End: Original strand, 2480253 - 2480375
Alignment:
| Q |
235 |
ttttcacctagtatgtacctaacaaatgtgtattctcacttgatttcaaactgaatctta-ttttgtgtacaaattatgcaattctttatcttgcagtgt |
333 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| |||||||| ||||||||||||| ||||||||| |
|
|
| T |
2480253 |
ttttcacctagtatgttcctaacaaatgtgtattctcacctgatttcaaactgaatcttatttttgtgtccaaattatgcaat--------ttgcagtgt |
2480344 |
T |
|
| Q |
334 |
tcaatttctcactgataaatatgtgctacaa |
364 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |
|
|
| T |
2480345 |
tcaatttctcgctgataaatatgtgctacaa |
2480375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 102 - 141
Target Start/End: Original strand, 2480138 - 2480177
Alignment:
| Q |
102 |
tgttatctcatgctacttacatgttaattttactttttgg |
141 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2480138 |
tgttatctcatgctatttacatgttaattttactttttgg |
2480177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University