View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2566_low_26 (Length: 321)
Name: NF2566_low_26
Description: NF2566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2566_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 18 - 311
Target Start/End: Complemental strand, 12946153 - 12945860
Alignment:
| Q |
18 |
gtattacctttaataatcaccacaaattggcacaagnnnnnnnngtcaaaaataaaatatcaccacacattactgcgtgcaaaatatctatgccaaagtg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12946153 |
gtattacctttaataatcaccacaaattgccccaagtttgttttgtcgaaaataaaatatcaccacacattactgcgtgcaaaatatctatgccaaagtg |
12946054 |
T |
 |
| Q |
118 |
tggtcacaattaacaagcatgaatgaaagccaaacgtagagaaatt-aaggaccactctgaaagtagttaaccgtacaacaattccatgttgcatcattg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12946053 |
tggtcacaattaacaagcatgaatgaaagccaaacgtagagaaatttaaggac-actctcaaagtagttaaccgtacaacaattccatgttgcatcattg |
12945955 |
T |
 |
| Q |
217 |
actctgaattaaccttttatctcttctcatttcaacaacaatggcataaccaaattcacctaattccaaacaaaactccactatggatccctatg |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12945954 |
actctgaattaaccttttatctcttctcatttcaacaacaatggcataaccaaattcacctaattccaaacaaaactccactatggatccctatg |
12945860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University