View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2566_low_31 (Length: 298)
Name: NF2566_low_31
Description: NF2566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2566_low_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 17 - 287
Target Start/End: Complemental strand, 2768144 - 2767870
Alignment:
| Q |
17 |
acaaagttggtttaaattagaaggttttgttattacaaaaatgttttggaaatatgcattaataatacacatatatacttgcaattttactaatcctttt |
116 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2768144 |
acaaagttggtttaaattataaggttttgttattacaaaaatgttttggaaatatgcattaataatacacatatatacttgcaattgtactaatcctttt |
2768045 |
T |
|
| Q |
117 |
gcgt----gatgatagatatattcaatttgtatactttgataactaactcgttgagctcatgtggttaaaaatgaactttggttaaatttgattaagctt |
212 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2768044 |
gcgtacgtgatgatagatatattcaatttgtatactttgataactaactcgttgagctcatgtggttaaaaatgaactttggttaaatttgattaagctt |
2767945 |
T |
|
| Q |
213 |
tggtactattcgagttcgattttctattagaataatcattagtcagactttactttcattctagttaaatttctt |
287 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2767944 |
tggtactattcgagttcaattttctattagaataatcattagtcagactttactttcattctagttaaatttctt |
2767870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University