View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2566_low_37 (Length: 271)
Name: NF2566_low_37
Description: NF2566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2566_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 20 - 190
Target Start/End: Original strand, 53463102 - 53463272
Alignment:
| Q |
20 |
tactgcggtaactttctgaaattgtcgcattttactgtgtatatgcaaatgaagcggcgtgcggcagaaggatagaagggttattacaaataacttatgt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53463102 |
tactgcggtaactttctgaaattgtcgcattttactgtgtatatgcaaatgaagcggcgtgcggcagaaggatagaagggttattacaaataacttatgt |
53463201 |
T |
 |
| Q |
120 |
tctaattttaggtttattttgttttattgtgaattattagtagctgctaatgtagtgatccaaaaatgttg |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53463202 |
tctaattttaggtttattttgttttattgtgaattattagtagctgctaatgtagtgatccaaaaatgttg |
53463272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University