View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2566_low_39 (Length: 259)
Name: NF2566_low_39
Description: NF2566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2566_low_39 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 7 - 257
Target Start/End: Complemental strand, 2705875 - 2705625
Alignment:
| Q |
7 |
gcatcaaggtttgaccctactcggagcccaataaaatcctctacttttttatttcataagaaagtgcttattcttttaattatagtgaagaatttaaggc |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2705875 |
gcattaaggtttgaccctactcggagcccaataaaatcctctacttttttatttcataagaaagtgcttattcttttaattatagtgaagaatttaaggc |
2705776 |
T |
 |
| Q |
107 |
ttatcaatcatctttcaggtttcaagagatagtacctttgaagacctcaacagtaataggggcagaagatccatcagtggcaacaaattggaataatctt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2705775 |
ttatcaatcatctttcaggtttcaagagatagtacctttgaagacctcaacagtaataggggcagaagatccatcagtggcaacaaattggaataatctt |
2705676 |
T |
 |
| Q |
207 |
ataggaaaaaccctaaacaacaaatttgatttcccatggttaacacctatg |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2705675 |
ataggaaaaaccctaaacaacaaatttgatttcccatggttaacacctatg |
2705625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University