View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2566_low_42 (Length: 249)
Name: NF2566_low_42
Description: NF2566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2566_low_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 162
Target Start/End: Complemental strand, 39224815 - 39224655
Alignment:
| Q |
1 |
aaataaagaataaggtgtgacttgcatgtatgtgttcatgttggctaggtgttaatttttcctaactagctagtttgtgttatttgaaaattttgaagat |
100 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39224815 |
aaataaagaataaggtgtgacttgtatctatgtgttcatgttggctaggtgttaatttt-cctaactagctagtttgtgttatttgagaattttgaagat |
39224717 |
T |
 |
| Q |
101 |
tttgtttaactatttattagctagagttggacctgttcnnnnnnntaaaactatagttggta |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39224716 |
tttgtttaactatttattagctagagttggacctgttcaaaaaaataaaactatagttggta |
39224655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University