View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2566_low_47 (Length: 244)
Name: NF2566_low_47
Description: NF2566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2566_low_47 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 119 - 225
Target Start/End: Complemental strand, 52783559 - 52783454
Alignment:
| Q |
119 |
ggaggtggataaataaccaaacaaattaataaataatattaattcattcacgtagtgaaagaagttgattgttctacatggctttctttcaacttgaatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52783559 |
ggaggtggataaataaccaaacaaattaataa-taatattaattcattcacgtagtgaaaggagttgattgttctacatggctttctttcaacttgaatt |
52783461 |
T |
|
| Q |
219 |
tgagcaa |
225 |
Q |
| |
|
||||||| |
|
|
| T |
52783460 |
tgagcaa |
52783454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 66 - 103
Target Start/End: Complemental strand, 52783622 - 52783585
Alignment:
| Q |
66 |
gagaagcttcatatagtgaatgatccacacatgaatgc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52783622 |
gagaagcttcatatagtgaatgatccacacatgaatgc |
52783585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University