View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2566_low_53 (Length: 238)

Name: NF2566_low_53
Description: NF2566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2566_low_53
NF2566_low_53
[»] chr5 (1 HSPs)
chr5 (19-217)||(8857856-8858054)


Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 217
Target Start/End: Original strand, 8857856 - 8858054
Alignment:
19 tggagagcgtggggaggtaaagcattattggagcaccaaccaacatatcttaagatggtgatgttttattttaaatatgttctcaaaattttcaatggtc 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
8857856 tggagagcgtggggaggtaaagcattattggagcaccaaccaacatatcttaagatggtgatgttttattttaaatatgttctcaaatttttcaatggtc 8857955  T
119 atccaagttttggtagcgaatcaaatgctacttttgtgcgcataccattccactcttatgatgataaatcaatctttaacctaaacaatgtccataata 217  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8857956 atccaagttttggtagcgaatcaaatgctacttttgtgcgcataccattccactcttatgatgataaatcaatctttaacctaaacaatgtccataata 8858054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University