View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2566_low_9 (Length: 492)
Name: NF2566_low_9
Description: NF2566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2566_low_9 |
 |  |
|
| [»] scaffold1030 (2 HSPs) |
 |  |  |
|
| [»] scaffold0178 (1 HSPs) |
 |  |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold0054 (1 HSPs) |
 |  |  |
|
| [»] scaffold0119 (1 HSPs) |
 |  |  |
|
| [»] scaffold0118 (1 HSPs) |
 |  |  |
|
| [»] scaffold0129 (1 HSPs) |
 |  |  |
|
| [»] scaffold0308 (1 HSPs) |
 |  |  |
|
| [»] scaffold0112 (1 HSPs) |
 |  |  |
|
| [»] scaffold0126 (1 HSPs) |
 |  |  |
|
| [»] scaffold0712 (1 HSPs) |
 |  |  |
|
| [»] scaffold0709 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
| [»] scaffold0219 (1 HSPs) |
 |  |  |
|
| [»] scaffold0070 (1 HSPs) |
 |  |  |
|
| [»] scaffold0809 (1 HSPs) |
 |  |  |
|
| [»] scaffold0707 (1 HSPs) |
 |  |  |
|
| [»] scaffold0294 (1 HSPs) |
 |  |  |
|
| [»] scaffold0246 (1 HSPs) |
 |  |  |
|
| [»] scaffold0034 (1 HSPs) |
 |  |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 419; Significance: 0; HSPs: 85)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 419; E-Value: 0
Query Start/End: Original strand, 19 - 465
Target Start/End: Complemental strand, 14258722 - 14258276
Alignment:
| Q |
19 |
agcaggttggtaggtaataatgcttaccatgaatgggagtatcatacaacaaaatataaaggactattagtggagcataatttgagtagatcatgtggaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14258722 |
agcaggttggtaggtaataatgcttaccatgaatgggagtagcatacaacaaaatataaaggactattagtggagcataatttgagtagatcatgtggaa |
14258623 |
T |
 |
| Q |
119 |
ctattagtgatgattctttctttcgacgccatcattcttatttgaaaagcaatagatccttgatttctttgattaaaaatcattcaaaaatgcctttgta |
218 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14258622 |
ctattagtgacgattctttctttcgacgccatcattcttatttgaaaagcaatagatccttgatttctttgattaaaaatcattcaaaaatgcctttgta |
14258523 |
T |
 |
| Q |
219 |
tattttccttgagactggtcgcttctggtttcctgctcaagtttataagctatgattatcaataacttactagttagtaagaataaagtgatgcttatta |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14258522 |
tattttccttgagactggtcgcttctggtttcctgctcaagtttataagctatgattatcaataacttactagttagtaagaataaagtgatgcttatta |
14258423 |
T |
 |
| Q |
319 |
aattgtggattgcatcctaagtaagaataactactatgtatttaataagaatcactttattagtttccgtgagcataactccgttgatagggacatgcat |
418 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |||| |||||||| |
|
|
| T |
14258422 |
aattgtggattgcatcctaagtaagaataactactatgtatttaataagaatcactttattagttcccgtgagcatagctccgttggtaggaacatgcat |
14258323 |
T |
 |
| Q |
419 |
tgctatatgcaggggtcagggttcgaaccctggacactccacttatt |
465 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
14258322 |
tgctatatgcagggatcagggttcgaaccctggacactccacttatt |
14258276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 183; E-Value: 9e-99
Query Start/End: Original strand, 19 - 285
Target Start/End: Complemental strand, 14284040 - 14283775
Alignment:
| Q |
19 |
agcaggttggtaggtaataatgcttaccatgaatgggagtatcatacaacaaaatataaaggactattagtggagcataatttgagtagatcatgtggaa |
118 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| ||||| | ||||| |
|
|
| T |
14284040 |
agcatgttggtaggtaatgatgcttaccatgaatgggagtatcatacaacaaaatataaaggactattagtggatcagaatttgaggagatcttctggaa |
14283941 |
T |
 |
| Q |
119 |
ctattagtgatgattctttctttcgacgccatcattcttatttgaaaagcaatagatccttgatttctttgattaaaaatcattcaaaaatgcctttgta |
218 |
Q |
| |
|
||||||||| |||||| || ||||||||||||||||||||||| ||||||||||||||||||||| |||| |||||||||||||| |||||| ||||||| |
|
|
| T |
14283940 |
ctattagtggtgattccttttttcgacgccatcattcttatttaaaaagcaatagatccttgattgcttttattaaaaatcattc-aaaatggctttgta |
14283842 |
T |
 |
| Q |
219 |
tattttccttgagactggtcgcttctggtttcctgctcaagtttataagctatgattatcaataact |
285 |
Q |
| |
|
|||||||||||||||| || ||||||| ||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
14283841 |
tattttccttgagactagttgcttctgctttcctgctcaagtttataaggtatgattatccataact |
14283775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 152; E-Value: 3e-80
Query Start/End: Original strand, 19 - 282
Target Start/End: Complemental strand, 14278562 - 14278299
Alignment:
| Q |
19 |
agcaggttggtaggtaataatgcttaccatgaatgggagtatcatacaacaaaatataaaggactattagtggagcataatttgagtagatcatgtggaa |
118 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| | |||||||||||| || ||| ||||| | ||| ||||| |
|
|
| T |
14278562 |
agcaggttggtaggtgatgatgcttaccatgaatgggagtatcatacaacaaaatataaggaactattagtggatcaaaatctgagtgaaccatttggaa |
14278463 |
T |
 |
| Q |
119 |
ctattagtgatgattctttctttcgacgccatcattcttatttgaaaagcaatagatccttgatttctttgattaaaaatcattcaaaaatgcctttgta |
218 |
Q |
| |
|
||||||||| ||||||| | || ||||| ||||||||||||||||| ||||||| |||||||| ||||||||||||||| ||||||||| ||||||| |
|
|
| T |
14278462 |
ctattagtggtgattctccatctcaacgccttcattcttatttgaaaatcaatagaaccttgattggtttgattaaaaatcactcaaaaatggctttgta |
14278363 |
T |
 |
| Q |
219 |
tattttccttgagactggtcgcttctggtttcctgctcaagtttataagctatgattatcaata |
282 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
14278362 |
tatcctccttgagactggtcgcttctggtttcctgctcaagtttataaggtatgattagcaata |
14278299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 293 - 380
Target Start/End: Complemental strand, 14283744 - 14283655
Alignment:
| Q |
293 |
tagtaagaataaagtgatgcttattaaattgtggattgcatcctaagtaagaataact--actatgtatttaataagaatcactttatta |
380 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| | |||| |||||||||||||||||||||||||||||| |
|
|
| T |
14283744 |
tagtaagaataaagtgatgcttactaaattgtggattgcatcctaagtaagtagaactacactatgtatttaataagaatcactttatta |
14283655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 17305514 - 17305606
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcaggg-ttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||| |||||||| |||| |||||||||||||| |||||||||||| ||||| |||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
17305514 |
ccgtgaacataactcagttggtagggacatgcattattatatgcagggggcaggggttcgaatcctggacaccccacttattcaccttgaaaa |
17305606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 293 - 366
Target Start/End: Complemental strand, 14278258 - 14278185
Alignment:
| Q |
293 |
tagtaagaataaagtgatgcttattaaattgtggattgcatcctaagtaagaataactactatgtatttaataa |
366 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| |||||| |||||||||||||||||||||| | ||||||||||| |
|
|
| T |
14278258 |
tagtaagaatgaagtgatgcttattacattatggattccatcctaagtaagaataactacaaagtatttaataa |
14278185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 407 - 476
Target Start/End: Original strand, 30833037 - 30833106
Alignment:
| Q |
407 |
agggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||| |||||| |||||||||| ||||||||| |
|
|
| T |
30833037 |
agggacatgcattgttatatgcaggggtcggggttcgaaccccggacaccccacttattctccttgaaaa |
30833106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 31639139 - 31639230
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||||||| ||||| ||||||| |||||| |||||| ||||| | | |||||||||| |||||||||||||||| ||||| |||| |
|
|
| T |
31639139 |
ccgtgagcataactcagttgacagggacacgcattgttatatgtaggggccggagttcgaacccaggacactccacttatttaccttaaaaa |
31639230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 5544274 - 5544365
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||| | |||||| ||||||||||||||| |||| |||||||||||||| |||||||||||| || || |||||||||| |||| |||| |
|
|
| T |
5544274 |
ccgtgaacttaactcagttgatagggacatgtattgttatatgcaggggtcggggttcgaaccccagataccccacttattctccttaaaaa |
5544365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 24256914 - 24257005
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||||| || |||| ||| |||||||||| |||||||||||| | ||||||||||| ||| || |||||||||||||||||||| |
|
|
| T |
24256914 |
ccgtgagcataagtcagttggtagagacatgcattattatatgcaggggccgaggttcgaaccccggataccccacttattcaccttgaaaa |
24257005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 34524873 - 34524964
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||| |||| |||||||||||||| |||||||||||| | |||||||| ||| | |||| |||||||||||||| ||||| |
|
|
| T |
34524873 |
ccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggccggggttcgagccccgaacaccccacttattcacctggaaaa |
34524964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 384 - 482
Target Start/End: Original strand, 13094457 - 13094555
Alignment:
| Q |
384 |
tccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaatgatga |
482 |
Q |
| |
|
|||||||||||||||| ||| | ||| | ||| |||| |||||| || ||||||||||||||||| | |||||||||||||| || ||||||| ||||| |
|
|
| T |
13094457 |
tccgtgagcataactcagttaaaaggaatatgtattgttatatgtagaggtcagggttcgaaccccgaacactccacttatttactttgaaaaagatga |
13094555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 385 - 471
Target Start/End: Complemental strand, 22389847 - 22389761
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| ||| |||| |||| ||||||| |||||||||||||||||||||||| || |||||| ||||||||||||||| |
|
|
| T |
22389847 |
ccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggtcagggttcgaatcccggacaccccacttattcacctt |
22389761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 388 - 476
Target Start/End: Original strand, 8309165 - 8309253
Alignment:
| Q |
388 |
tgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||| ||| |||| |||||||||||||| |||||||| ||| || | ||||||||| |||||| |||| ||||||||||||||| |
|
|
| T |
8309165 |
tgagcatagctcagttggcagggacatgcattgttatatgcatgggccaagtttcgaaccccggacaccccacctattcaccttgaaaa |
8309253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 385 - 468
Target Start/End: Complemental strand, 14981800 - 14981716
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| ||| |||| ||||||| |||||| |||||||||||| | ||||||||||||||||||| |||||||||||| |
|
|
| T |
14981800 |
ccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccctggacaccccacttattcac |
14981716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 392 - 476
Target Start/End: Original strand, 17347260 - 17347343
Alignment:
| Q |
392 |
cataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||| |||| ||||| |||||||| |||||||| ||||| ||||||||||| ||||||| ||||||||||||||| |||| |
|
|
| T |
17347260 |
cataactcagttggcagggatatgcattgttatatgcatgggtc-gggttcgaaccttggacaccccacttattcaccttaaaaa |
17347343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 384 - 476
Target Start/End: Complemental strand, 30668282 - 30668190
Alignment:
| Q |
384 |
tccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||||||||| |||| | |||||||||| |||||||||||||||| ||||||||| | |||| ||||||||||||||| |||| |
|
|
| T |
30668282 |
tccgtgagcataactcagttggcatagacatgcattattatatgcaggggtcagagttcgaaccacgaacaccccacttattcaccttaaaaa |
30668190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 409 - 476
Target Start/End: Complemental strand, 19680321 - 19680254
Alignment:
| Q |
409 |
ggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||||| |||||||||| | | |||||||||||| |||||| |||||||||| ||||||||| |
|
|
| T |
19680321 |
ggacatgcattgttatatgcaggagccggggttcgaaccccggacaccccacttattctccttgaaaa |
19680254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 26669756 - 26669665
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||| |||| ||||||||||||| |||||| ||||| |||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
26669756 |
ccgtgagcatagctcagttggtagggacatgcataattatatgtaggggctggggttcgaaccccagacaccccacttattcaccttgaaaa |
26669665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 385 - 471
Target Start/End: Complemental strand, 7563673 - 7563587
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| ||| |||| |||| ||||||| || |||||||||||||||||| ||||| |||||| ||||||||||||||| |
|
|
| T |
7563673 |
ccgtgagcatagctcagttggtaggacaatgcattattacatgcaggggtcagggttcaaaccccggacaccccacttattcacctt |
7563587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 385 - 471
Target Start/End: Complemental strand, 9491832 - 9491746
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||||||| |||| |||| ||||||| |||||| ||||| | |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
9491832 |
ccgtgagcataactcagttggtaggacaatgcattattatatgtaggggccggggttcgaaccccggacaccccacttattcacctt |
9491746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 388 - 476
Target Start/End: Original strand, 4844144 - 4844232
Alignment:
| Q |
388 |
tgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||| ||||||| |||| |||||||||||||| |||||||||||||| ||||| |||| ||||| ||||||||||||||||||| |
|
|
| T |
4844144 |
tgagtataactcagttggcagggacatgcattgttatatgcaggggtcggggtttaaacctcagacacctcacttattcaccttgaaaa |
4844232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 9372233 - 9372193
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9372233 |
tatatgcaggggtcggggttcgaaccctggacactccactt |
9372193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 473
Target Start/End: Original strand, 9422831 - 9422919
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttga |
473 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||| ||||| || | | |||||||||| | |||||| ||||||||||||||||| |
|
|
| T |
9422831 |
ccgtgagcataactcagttggcagggacatgcattgttatatacaagagctggggttcgaacaccggacaccccacttattcaccttga |
9422919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 10455740 - 10455832
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggaca-ctccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| || |||| ||| |||||||||| |||||||||||| | |||||||||||| ||||| | |||||||||| ||||||||| |
|
|
| T |
10455740 |
ccgtgagcatagttcagttggcaggaacatgcattgttatatgcaggggccggggttcgaaccccggacacccccacttattctccttgaaaa |
10455832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 28030902 - 28030942
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28030902 |
tatatgcaggggccagggttcgaaccctggacactccactt |
28030942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 409 - 476
Target Start/End: Complemental strand, 8253663 - 8253597
Alignment:
| Q |
409 |
ggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
8253663 |
ggacatgcattgttatatgcaggggctggggttcgaaccc-agacaccccacttattcaccttgaaaa |
8253597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 422 - 468
Target Start/End: Complemental strand, 30338 - 30292
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||| ||||| |
|
|
| T |
30338 |
tatatgcaggggccggggttcgaaccctggacactccacttcttcac |
30292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 385 - 471
Target Start/End: Complemental strand, 9443560 - 9443474
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| ||| ||||||| |||||||||||| |||||| | ||||| || |||||||| ||||| |||||||||| |||| |
|
|
| T |
9443560 |
ccgtgagcatagctcagttgatacggacatgcattgttatatgtatgggtcgggattcgaacctcagacaccccacttattctcctt |
9443474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 385 - 471
Target Start/End: Original strand, 12089095 - 12089181
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| ||| |||| |||| ||||||| |||||||||||| | | |||||||||| |||||| ||||||||||||||| |
|
|
| T |
12089095 |
ccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggagttcgaaccccggacaccccacttattcacctt |
12089181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 413 - 471
Target Start/End: Complemental strand, 25020597 - 25020539
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
25020597 |
atgcattattatatgcaggggcctgggttcgaaccccggacaccccacttattcacctt |
25020539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 422 - 471
Target Start/End: Complemental strand, 753372 - 753323
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||| |||||||||| |||| |
|
|
| T |
753372 |
tatatgtaggggtcggggttcgaaccctggacaccccacttattcccctt |
753323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 409 - 477
Target Start/End: Original strand, 962272 - 962341
Alignment:
| Q |
409 |
ggacatgcattgctatatgcaggggtcagggttcgaacc-ctggacactccacttattcaccttgaaaat |
477 |
Q |
| |
|
|||||||||||||||||| | ||||||| ||||||||| |||||||| ||| ||||||||||| ||||| |
|
|
| T |
962272 |
ggacatgcattgctatatataagggtcagagttcgaacctctggacaccccatttattcaccttaaaaat |
962341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 385 - 465
Target Start/End: Original strand, 2945593 - 2945674
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttatt |
465 |
Q |
| |
|
||||||||||| ||| |||| ||||||| ||||||| |||||||||||||| |||||| |||| |||||| ||||||||| |
|
|
| T |
2945593 |
ccgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggtcggggttcaaacctcggacaccccacttatt |
2945674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 386 - 471
Target Start/End: Complemental strand, 12128005 - 12127920
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||||| ||| |||| |||| ||||||| |||||||||||||| | ||||||||| |||||| ||||||||||||||| |
|
|
| T |
12128005 |
cgtgagcatagctcagttggtaggacaatgcattattatatgcaggggtcggaattcgaaccccggacacgccacttattcacctt |
12127920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 422 - 471
Target Start/End: Complemental strand, 20568317 - 20568268
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||||||||| |||||||||||| | |||| ||||||||||||||| |
|
|
| T |
20568317 |
tatatgcaggggtcggggttcgaaccccgaacaccccacttattcacctt |
20568268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 390 - 471
Target Start/End: Complemental strand, 20858475 - 20858394
Alignment:
| Q |
390 |
agcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||||| |||| |||||||||||||| ||||||||||||| ||||||||| | |||||| ||| ||||| ||||| |
|
|
| T |
20858475 |
agcataactcagttggcagggacatgcattgttatatgcaggggttggggttcgaattccggacaccccatttatttacctt |
20858394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 410 - 478
Target Start/End: Original strand, 1488111 - 1488179
Alignment:
| Q |
410 |
gacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaatg |
478 |
Q |
| |
|
||||||||||| ||||||||| |||| |||||||||||| |||| ||| ||||||||||| |||||| |
|
|
| T |
1488111 |
gacatgcattgttatatgcagaggtcggggttcgaaccccaaacaccccatttattcaccttaaaaatg |
1488179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 383 - 471
Target Start/End: Complemental strand, 5288444 - 5288356
Alignment:
| Q |
383 |
ttccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||||||||| |||| |||| ||||||| |||||||||||||| |||| ||||| | |||||| || ||||||||||| |
|
|
| T |
5288444 |
ttccgtgagcataactcagttggtaggacaatgcattattatatgcaggggtcggggtccgaactccggacacctcaattattcacctt |
5288356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 468
Target Start/End: Original strand, 6143962 - 6144045
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| ||| |||| ||||||| |||||| |||||| ||||||| |||||||||||| |||||| |||||||||||| |
|
|
| T |
6143962 |
ccgtgagcatagctcagttggcagggacaatgcattattatatgtaggggtc-gggttcgaaccccggacaccccacttattcac |
6144045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 10483568 - 10483528
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
10483568 |
tatatgcaggggtcggggttcgaaccccggacactccactt |
10483528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 10517237 - 10517277
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
10517237 |
tatatgcaggggtcggggttcgaaccccggacactccactt |
10517277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 389 - 476
Target Start/End: Complemental strand, 20150073 - 20149985
Alignment:
| Q |
389 |
gagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccc-tggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||| ||| |||| |||||| ||| ||| |||||| |||| | |||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
20150073 |
gagcatagctcagttgggagggacttgcgttgttatatgtagggattggggttcgaacccctggacaccccacttattcaccttgaaaa |
20149985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 389 - 476
Target Start/End: Original strand, 22182759 - 22182847
Alignment:
| Q |
389 |
gagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccc-tggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||| ||| |||| |||||| ||| ||| |||||| |||| | |||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
22182759 |
gagcatagctcagttgggagggacttgcgttgttatatgtagggattggggttcgaacccctggacaccccacttattcaccttgaaaa |
22182847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 31935137 - 31935177
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
31935137 |
tatatgcaggggtcggggttcgaaccccggacactccactt |
31935177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 34883738 - 34883827
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||||||| |||| ||||||||||| || |||| ||| |||| |||||| |||| |||||| ||||||||||||||| |||| |
|
|
| T |
34883738 |
ccgtgagcataactcagttggtagggacatgcgttattatacgcaagggttggggttcaaacc--ggacaccccacttattcaccttaaaaa |
34883827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 467
Target Start/End: Original strand, 3448349 - 3448432
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
||||||||||| ||| ||| ||||||| ||||||| |||| ||||||| | |||||||||||| |||||| ||||||||||| |
|
|
| T |
3448349 |
ccgtgagcatagctcaattggcagggacaatgcattgttatacgcaggggccggggttcgaaccccggacaccccacttattca |
3448432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 8175994 - 8176085
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||| ||||| || ||||||||||| ||||||||||| | |||||||| | | |||| ||||||||||||||| |||| |
|
|
| T |
8175994 |
ccgtgagcatagctcagttgacagagacatgcattgttatatgcagggactggtgttcgaactccgaacaccccacttattcaccttaaaaa |
8176085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 409 - 475
Target Start/End: Complemental strand, 17751410 - 17751344
Alignment:
| Q |
409 |
ggacatgcattgctatatgcaggggtcag-ggttcgaaccctggacactccacttattcaccttgaaa |
475 |
Q |
| |
|
|||||||||||| |||||||||| | ||| ||||||||||| |||||| |||||||||||| |||||| |
|
|
| T |
17751410 |
ggacatgcattgttatatgcaggag-cagaggttcgaaccccggacaccccacttattcactttgaaa |
17751344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 422 - 464
Target Start/End: Original strand, 389371 - 389413
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttat |
464 |
Q |
| |
|
|||||||||||||| | |||||||||| ||||||||||||||| |
|
|
| T |
389371 |
tatatgcaggggtcggagttcgaaccccggacactccacttat |
389413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 386 - 476
Target Start/End: Original strand, 3029965 - 3030055
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||||| |||| |||||||| ||| |||||| || ||| | ||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
3029965 |
cgtgagcataacttagttggcagggacataaattattatatgtagtggttggagttcgaaccctggacaccccacttattcaccttaaaaa |
3030055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 422 - 468
Target Start/End: Original strand, 3294802 - 3294848
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||| |||||| ||||| |
|
|
| T |
3294802 |
tatatgcaggggtcggggttcgaaccccggacaccccacttcttcac |
3294848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 385 - 467
Target Start/End: Complemental strand, 6025483 - 6025402
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
|||| |||||||||| |||| |||| ||||||| |||||||||||||| || ||||||||| ||||| |||||||||||| |
|
|
| T |
6025483 |
ccgtaagcataactcagttggtaggataatgcattattatatgcaggggtcgggattcgaaccccggaca-tccacttattca |
6025402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 471
Target Start/End: Original strand, 9438328 - 9438386
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||| |||||| ||||| ||||||||| |
|
|
| T |
9438328 |
atgcattattatatgcaggggttggggttcgaaccccggacaccccactcattcacctt |
9438386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 385 - 467
Target Start/End: Complemental strand, 25064766 - 25064684
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
||||||||||| || |||| || ||||||||||| ||||||||||||| |||||||||||| ||||| |||||| |||| |
|
|
| T |
25064766 |
ccgtgagcatagttcagttggtatggacatgcattattatatgcaggggttggggttcgaaccccagacaccccacttcttca |
25064684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 471
Target Start/End: Original strand, 26528593 - 26528651
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||| |||||||||||||| |||||| |||| |||||| ||||||||||||||| |
|
|
| T |
26528593 |
atgcattattatatgcaggggtcggggttcaaacctcggacaccccacttattcacctt |
26528651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 467
Target Start/End: Complemental strand, 31949894 - 31949840
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||| | | |||||||||| |
|
|
| T |
31949894 |
atgcattattatatgcaggggtcggggttcgaaccctggatatttcacttattca |
31949840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 385 - 462
Target Start/End: Complemental strand, 33697182 - 33697105
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacat-gcattgctatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||| |||||| ||||||||||| || ||||| |||||||||||||| | ||||||| || ||||||||||||| |
|
|
| T |
33697182 |
ccgtgagcttaactcagttgatagggatattgcattt-tatatgcaggggtcggagttcgaatcccggacactccactt |
33697105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 471
Target Start/End: Original strand, 35190789 - 35190847
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||| |||||||||||||| | |||||||||| | |||| ||||||||||||||| |
|
|
| T |
35190789 |
atgcattattatatgcaggggtcggagttcgaaccccgaacaccccacttattcacctt |
35190847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 407 - 476
Target Start/End: Complemental strand, 2955179 - 2955110
Alignment:
| Q |
407 |
agggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||||| |||||||||||| ||||| |||||||||| || ||||| ||||||||| |||| |
|
|
| T |
2955179 |
agggacatgcattattatatgcaggggcaggggtttgaaccctggataccccactgattcaccttaaaaa |
2955110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 422 - 471
Target Start/End: Complemental strand, 6270669 - 6270620
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||||||| | |||||||||||||| |||| ||| ||||||||||| |
|
|
| T |
6270669 |
tatatgcaggggccggggttcgaaccctgaacaccccaattattcacctt |
6270620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 422 - 471
Target Start/End: Complemental strand, 6658603 - 6658554
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||||||| | |||||||||||| |||||| |||||||||| |||| |
|
|
| T |
6658603 |
tatatgcaggggccggggttcgaaccccggacaccccacttattctcctt |
6658554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 407 - 476
Target Start/End: Complemental strand, 7374125 - 7374056
Alignment:
| Q |
407 |
agggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||||||| |||||| | ||||| | |||||||| | | |||| ||||||||||||||| |||| |
|
|
| T |
7374125 |
agggacatgcattgttatatgtatgggtcggagttcgaactccgaacaccccacttattcaccttaaaaa |
7374056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 385 - 465
Target Start/End: Original strand, 9064863 - 9064944
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttatt |
465 |
Q |
| |
|
||||||||||| ||| |||| ||||||| |||||| |||||||||||| | |||||||||||| ||||| ||||||||| |
|
|
| T |
9064863 |
ccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccagacaccccacttatt |
9064944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 386 - 471
Target Start/End: Complemental strand, 10424630 - 10424546
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||||||||| |||||||| | ||||||| |||||| ||||||| |||| ||| || |||||| ||||||||||||||| |
|
|
| T |
10424630 |
cgtgagcataactcagttgatagaca-atgcattattatatgtaggggtcgtggtttgaatcccggacaccccacttattcacctt |
10424546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 422 - 459
Target Start/End: Complemental strand, 16913932 - 16913895
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactcca |
459 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
16913932 |
tatatgcaggggtcggggttcgaaccccggacactcca |
16913895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 426 - 467
Target Start/End: Complemental strand, 20415618 - 20415577
Alignment:
| Q |
426 |
tgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
|||||||| |||||||||||||| |||||| ||||||||||| |
|
|
| T |
20415618 |
tgcaggggccagggttcgaaccccggacaccccacttattca |
20415577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 422 - 467
Target Start/End: Original strand, 22983615 - 22983660
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
|||||||||||| | |||||||||||| |||||| ||||||||||| |
|
|
| T |
22983615 |
tatatgcaggggccggggttcgaaccccggacaccccacttattca |
22983660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 422 - 467
Target Start/End: Complemental strand, 23804793 - 23804748
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
|||||||||||| | |||||||||||| |||||| ||||||||||| |
|
|
| T |
23804793 |
tatatgcaggggccggggttcgaaccccggacaccccacttattca |
23804748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 416 - 477
Target Start/End: Complemental strand, 25165261 - 25165200
Alignment:
| Q |
416 |
cattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaat |
477 |
Q |
| |
|
||||| ||||| ||| ||||| ||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
25165261 |
cattgttatatataggagtcagagttcgaaccctcaatactccacttattcaccttgaaaat |
25165200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 388 - 468
Target Start/End: Original strand, 29284118 - 29284199
Alignment:
| Q |
388 |
tgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
|||||||||||| |||| |||| ||| || ||| |||||| |||| || |||||||||||| |||||| |||||||||||| |
|
|
| T |
29284118 |
tgagcataactcagttggtaggaacaatgtattattatatgtagggatcggggttcgaaccccggacaccccacttattcac |
29284199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 492940 - 492980
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||| |||||| |
|
|
| T |
492940 |
tatatgcaggggccggggttcgaaccctggacaccccactt |
492980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 1435847 - 1435887
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||| ||||||| |
|
|
| T |
1435847 |
tatatgcaggggccagggttcgaaccccggacattccactt |
1435887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 7418316 - 7418356
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| | | |||||||||||||||||||||||| |
|
|
| T |
7418316 |
tatatgcaggggcctgagttcgaaccctggacactccactt |
7418356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 7865387 - 7865347
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| | ||||| |||||||||||||||||||| |
|
|
| T |
7865387 |
tatatgcaggggccggggtttgaaccctggacactccactt |
7865347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 7897150 - 7897110
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||| |||||| |
|
|
| T |
7897150 |
tatatgcaggggtcggggttcgaaccccggacaccccactt |
7897110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 454
Target Start/End: Original strand, 9234114 - 9234146
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggaca |
454 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
9234114 |
tatatgcaggggtcagggttcgaaccctagaca |
9234146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 385 - 445
Target Start/End: Original strand, 10442883 - 10442943
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaa |
445 |
Q |
| |
|
||||||||||||||| |||||||| || || ||||| |||||| |||||| ||||||||| |
|
|
| T |
10442883 |
ccgtgagcataactcagttgatagagatatacattgttatatgtaggggttggggttcgaa |
10442943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 10913111 - 10913071
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
10913111 |
tatatgcaggggtcggggttcgaaccccagacactccactt |
10913071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 17454777 - 17454737
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
17454777 |
tatatgcaggagtcggggttcgaaccccggacactccactt |
17454737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 18904303 - 18904343
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||| |||||| |
|
|
| T |
18904303 |
tatatgcaggggtcggggttcgaaccccggacaccccactt |
18904343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 19892308 - 19892268
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||| ||||||| |||||||||||| ||||||||||||| |
|
|
| T |
19892308 |
tatatgtaggggtcggggttcgaaccccggacactccactt |
19892268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 431 - 467
Target Start/End: Original strand, 21619035 - 21619070
Alignment:
| Q |
431 |
gggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
21619035 |
gggtcagggttcgaaccctggacac-ccacttattca |
21619070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 30916359 - 30916399
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
30916359 |
tatatgcgggggttggggttcgaaccctggacactccactt |
30916399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 33573855 - 33573895
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||| | | |||||||||||||||||||||||||| |
|
|
| T |
33573855 |
tatatgcaggagccggggttcgaaccctggacactccactt |
33573895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1030 (Bit Score: 148; Significance: 7e-78; HSPs: 2)
Name: scaffold1030
Description:
Target: scaffold1030; HSP #1
Raw Score: 148; E-Value: 7e-78
Query Start/End: Original strand, 19 - 282
Target Start/End: Original strand, 2928 - 3191
Alignment:
| Q |
19 |
agcaggttggtaggtaataatgcttaccatgaatgggagtatcatacaacaaaatataaaggactattagtggagcataatttgagtagatcatgtggaa |
118 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||| |||||||||||||||||| ||| | |||||||||||| || ||| ||||| | ||| ||||| |
|
|
| T |
2928 |
agcaggttggtaggtgatgatgcttaccatgaatggaagtatcatacaacaaaatgtaaggaactattagtggatcaaaatctgagtgaaccatttggaa |
3027 |
T |
 |
| Q |
119 |
ctattagtgatgattctttctttcgacgccatcattcttatttgaaaagcaatagatccttgatttctttgattaaaaatcattcaaaaatgcctttgta |
218 |
Q |
| |
|
||||||||| ||||||| | || ||||| ||||||||||||||||| ||||||| |||||||| ||||||||||||||| ||||||||| ||||||| |
|
|
| T |
3028 |
ctattagtggtgattctccatctcaacgccttcattcttatttgaaaatcaatagaaccttgattggtttgattaaaaatcactcaaaaatggctttgta |
3127 |
T |
 |
| Q |
219 |
tattttccttgagactggtcgcttctggtttcctgctcaagtttataagctatgattatcaata |
282 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
3128 |
tatcttccttgagactggtcgcttctggtttcctgctcaagtttataaggtatgattagcaata |
3191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1030; HSP #2
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 293 - 352
Target Start/End: Original strand, 3225 - 3284
Alignment:
| Q |
293 |
tagtaagaataaagtgatgcttattaaattgtggattgcatcctaagtaagaataactac |
352 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| |||||| |||||||||||||||||||||| |
|
|
| T |
3225 |
tagtaagaatgaagtgatgcttattacattatggattccatcctaagtaagaataactac |
3284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 123; Significance: 6e-63; HSPs: 83)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 6e-63
Query Start/End: Original strand, 19 - 285
Target Start/End: Complemental strand, 35138821 - 35138555
Alignment:
| Q |
19 |
agcaggttggtaggtaataatgcttaccatgaatgggagtatcatacaacaaaatataaaggactattagtggagcataatttgagtagatcatgtggaa |
118 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| | |||||||||||| || ||| ||||| |||| |||| |
|
|
| T |
35138821 |
agcaggttgctaggtaatgatgcttaccatgaatgggagtatcatacaacaaaatataaggaactattagtggatcagaatctgagtgactcattaggaa |
35138722 |
T |
 |
| Q |
119 |
ctattagtgatgattctttctttcgacgccatcattcttatttgaaaagcaatagatccttgatttctttgattaaaaatcattcaaaaatgcctttgta |
218 |
Q |
| |
|
||| ||||| | |||||| |||| ||| |||||||||||||| || |||||||||| ||| | ||||||||||||||||||||||||| || | || |
|
|
| T |
35138721 |
ctactagtggtaattcttcatttcaacgaattcattcttatttgagaatcaatagatccatgactgatttgattaaaaatcattcaaaaatggctctata |
35138622 |
T |
 |
| Q |
219 |
tattttccttgagactggtcgcttctggtttcctgctcaagtttataagctatgattatcaataact |
285 |
Q |
| |
|
|||||| ||||||||||| || ||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
35138621 |
tatttttcttgagactggccgtttctggtttcctgctcaagtttataaggtatgattaaaaataact |
35138555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 19 - 285
Target Start/End: Complemental strand, 35131513 - 35131247
Alignment:
| Q |
19 |
agcaggttggtaggtaataatgcttaccatgaatgggagtatcatacaacaaaatataaaggactattagtggagcataatttgagtagatcatgtggaa |
118 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| | |||||||||||| | ||| |||| |||| |||| |
|
|
| T |
35131513 |
agcaggttgctaggtaatgatgcttaccatgaatgggagtatcatacaacaaaatataaggaactattagtggatcggaatctgagcgactcattaggaa |
35131414 |
T |
 |
| Q |
119 |
ctattagtgatgattctttctttcgacgccatcattcttatttgaaaagcaatagatccttgatttctttgattaaaaatcattcaaaaatgcctttgta |
218 |
Q |
| |
|
||| ||||| | |||||| |||| ||| |||||||||||||| || |||||||||| ||| | ||||||||||||||||||||||||| || | || |
|
|
| T |
35131413 |
ctactagtggtaattcttcatttcaacgaattcattcttatttgagaatcaatagatccatgactgatttgattaaaaatcattcaaaaatggctctata |
35131314 |
T |
 |
| Q |
219 |
tattttccttgagactggtcgcttctggtttcctgctcaagtttataagctatgattatcaataact |
285 |
Q |
| |
|
|||||| ||||||||||| || ||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
35131313 |
tatttttcttgagactggccgtttctggtttcctgctcaagtttataaggtatgattaacaataact |
35131247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 385 - 478
Target Start/End: Original strand, 1649150 - 1649243
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaatg |
478 |
Q |
| |
|
||||||||||| ||| |||| |||||| |||||||| | |||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1649150 |
ccgtgagcatagctcagttggtagggatatgcattgttttatgcaggggccagggttcgaaccctggacaccccacttattcaccttgaaaatg |
1649243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 385 - 471
Target Start/End: Original strand, 11808036 - 11808122
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||| || ||| ||| ||||||||||||||| |||||||||||||| |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
11808036 |
ccgtgagcttagctcaattggtagggacatgcattgttatatgcaggggtcggggttcgaaccccggacaccccacttattcacctt |
11808122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 385 - 471
Target Start/End: Original strand, 43635586 - 43635672
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||||||| |||| || |||||||||| ||||||||| |||| |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
43635586 |
ccgtgagcataactcagttggcagaaacatgcattgttatatgcagcggtcggggttcgaaccccggacaccccacttattcacctt |
43635672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 476
Target Start/End: Complemental strand, 37410579 - 37410487
Alignment:
| Q |
384 |
tccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||||| ||| |||| || |||||||||||| ||||||||||||||| ||||||||| | |||||| ||||||||| |||| |||| |
|
|
| T |
37410579 |
tccgtgagcatagctcagttggtaaggacatgcattgttatatgcaggggtcaaggttcgaactccggacacctcacttattctccttaaaaa |
37410487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 388 - 476
Target Start/End: Complemental strand, 43712407 - 43712319
Alignment:
| Q |
388 |
tgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||| |||||||| ||||||||||| ||| || |||||||| | ||||||||| |
|
|
| T |
43712407 |
tgagcataactcagttggtagggacatgcattgttatatacaggggtcggggttcgaacctcggataccccacttatcctccttgaaaa |
43712319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 385 - 471
Target Start/End: Complemental strand, 21285451 - 21285364
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| ||| |||| ||||||| ||||||| |||||||||||| | |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
21285451 |
ccgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggccggggttcgaaccccggacaccccacttattcacctt |
21285364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 384 - 467
Target Start/End: Original strand, 32814824 - 32814907
Alignment:
| Q |
384 |
tccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||| |||||||||||||| | ||||||| || |||||| ||||||||||| |
|
|
| T |
32814824 |
tccgtgagcatagctcagttggtagggacatgcattattatatgcaggggtcggagttcgaatcccggacaccccacttattca |
32814907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 385 - 471
Target Start/End: Original strand, 2366355 - 2366441
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||| ||||||| ||||||||| ||||||| |||||||||||||| |||||||||| || ||||| ||||||||||||||| |
|
|
| T |
2366355 |
ccgtgagtataactcagttgataggacaatgcattattatatgcaggggtcggggttcgaactctagacaccccacttattcacctt |
2366441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 387 - 476
Target Start/End: Original strand, 44409201 - 44409289
Alignment:
| Q |
387 |
gtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||||| ||| ||||||||||||| |||||||| ||||| |||||||||||| | |||| |||||||||||||||||||| |
|
|
| T |
44409201 |
gtgagcataactcagttagcagggacatgcattattatatgcaagggtcggggttcgaaccc-gaacaccccacttattcaccttgaaaa |
44409289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 392 - 476
Target Start/End: Complemental strand, 10020559 - 10020475
Alignment:
| Q |
392 |
cataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||| ||| ||||| |||||||||||||| ||||||||||||| |||||||||||| | ||| ||||||||||| |||||||| |
|
|
| T |
10020559 |
catagctcagttgacagggacatgcattgttatatgcaggggttggggttcgaaccccgaacaacccacttattcatcttgaaaa |
10020475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 391 - 475
Target Start/End: Original strand, 24427367 - 24427451
Alignment:
| Q |
391 |
gcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaa |
475 |
Q |
| |
|
||||||||| |||| || ||||||||||| ||||||||||||||| ||||||||||| | | || ||| ||||||||||||||| |
|
|
| T |
24427367 |
gcataactcagttggcagagacatgcattgttatatgcaggggtcaaggttcgaaccccgaataccccatttattcaccttgaaa |
24427451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 387 - 478
Target Start/End: Original strand, 1513487 - 1513578
Alignment:
| Q |
387 |
gtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaatg |
478 |
Q |
| |
|
|||||||||| || |||| |||||||||||||| |||||| |||||| ||||||||| | | |||| |||||||||||||||||||||| |
|
|
| T |
1513487 |
gtgagcataaatcagttggcagggacatgcattgttatatgtaggggttgaggttcgaacaccgaacaccccacttattcaccttgaaaatg |
1513578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 7162765 - 7162674
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||| |||||||| ||| ||||| |||||||| |||||||||||||| |||||||||| ||| | | |||||||||||| |||||||| |
|
|
| T |
7162765 |
ccgtgaacataactcgattggcagggatatgcattgttatatgcaggggtcggggttcgaactctgaatattccacttattcatcttgaaaa |
7162674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 35195841 - 35195932
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||| |||||| ||| |||| ||||||||||||| |||||||||||| | |||||||||||| | |||| ||| |||||||||||||||| |
|
|
| T |
35195841 |
ccgtaagcatagctcagttggcagggacatgcattattatatgcaggggccggggttcgaaccccgaacaccccatttattcaccttgaaaa |
35195932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 386 - 476
Target Start/End: Complemental strand, 10474608 - 10474518
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||| || |||| ||| ||||| ||||| |||||||||||||| |||||||| ||| |||||| |||||||||||||| |||| |
|
|
| T |
10474608 |
cgtgagcatagttcagttggtagagacatacattgttatatgcaggggtcggggttcgacccccggacacctcacttattcaccttaaaaa |
10474518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 413 - 471
Target Start/End: Complemental strand, 29658341 - 29658283
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||| |||||||||||| | |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
29658341 |
atgcattgttatatgcaggggccggggttcgaaccccggacaccccacttattcacctt |
29658283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 387 - 468
Target Start/End: Original strand, 38451862 - 38451944
Alignment:
| Q |
387 |
gtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||| ||| ||||| ||||||| ||||||| |||||||||||| | ||||||||| || |||||| |||||||||||| |
|
|
| T |
38451862 |
gtgagcatagctcagttgacagggacaatgcattgttatatgcaggggccggggttcgaatcccggacaccccacttattcac |
38451944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 406 - 476
Target Start/End: Original strand, 5773148 - 5773220
Alignment:
| Q |
406 |
tagggacatgcattgctatatgcaggggtcagggttcgaaccctggacac--tccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||||||| |||||| ||||||| ||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
5773148 |
tagggacatgcattgttatatgtaggggtcgaggttcgaaccccggacacatcccacttattcaccttgaaaa |
5773220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 411 - 476
Target Start/End: Original strand, 16814721 - 16814786
Alignment:
| Q |
411 |
acatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||| |||||| ||||||| |||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
16814721 |
acatgcattattatatgtaggggtcggggttcgaaccccagacactccacttattcactttgaaaa |
16814786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 422 - 467
Target Start/End: Original strand, 33555104 - 33555149
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33555104 |
tatatgcaagggtcagggttcgaaccccggacactccacttattca |
33555149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 38032952 - 38032860
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccac-ttattcaccttgaaaa |
476 |
Q |
| |
|
|||||| |||||||| |||| |||||||||||||| ||||| |||||| | |||||||||||| |||||| ||| || ||||||||||||| |
|
|
| T |
38032952 |
ccgtgaacataactcagttggcagggacatgcattgttatatacaggggccggggttcgaaccccggacacctcactttgttcaccttgaaaa |
38032860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 468
Target Start/End: Original strand, 41139084 - 41139168
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| ||| |||| ||||||| |||||| |||||||||||||| ||||||||| || ||||||| ||||||||||| |
|
|
| T |
41139084 |
ccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggtcggggttcgaatcccggacacttcacttattcac |
41139168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 41913796 - 41913756
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41913796 |
tatatgcaggggtcagggttcgaaccccggacactccactt |
41913756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 7392403 - 7392312
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||| ||| ||| |||||||||| ||||||||| ||| ||||| |||||| | |||| |||||||||||||||||||| |
|
|
| T |
7392403 |
ccgtgagcatagctcaattggcaggaacatgcattgttatatgcagaggttggggtttgaaccccgaacaccccacttattcaccttgaaaa |
7392312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 401 - 476
Target Start/End: Original strand, 9351048 - 9351123
Alignment:
| Q |
401 |
gttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||| ||||||||| ||| |||||||||||||| | |||||||||| | | |||||||||||||||||| |||| |
|
|
| T |
9351048 |
gttgacagggacatgtattattatatgcaggggtcggagttcgaaccccgaaaactccacttattcaccttaaaaa |
9351123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 37917390 - 37917481
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||| |||| |||| |||||||| ||||||||||||| |||||| |||||| |||| |||||||||||| ||||||| |
|
|
| T |
37917390 |
ccgtgagcatagctcagttggtaggaacatgcataattatatgcaggggttggggttcaaaccctaaacaccccacttattcactttgaaaa |
37917481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 385 - 463
Target Start/End: Original strand, 7465464 - 7465542
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccactta |
463 |
Q |
| |
|
||||||||||| ||| |||| || |||||||||| |||||||||||| | |||||||||||| |||||| ||||||| |
|
|
| T |
7465464 |
ccgtgagcatagctcagttggcagagacatgcattattatatgcaggggccggggttcgaaccccggacaccccactta |
7465542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 384 - 466
Target Start/End: Original strand, 23799297 - 23799379
Alignment:
| Q |
384 |
tccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattc |
466 |
Q |
| |
|
|||||| | ||||||| |||| || ||||||||||| |||||||||||||| || |||||||| |||||| |||||||||| |
|
|
| T |
23799297 |
tccgtgggtataactcagttggcagagacatgcattgttatatgcaggggtcgggattcgaacctcggacaccccacttattc |
23799379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 225 - 267
Target Start/End: Complemental strand, 35123224 - 35123182
Alignment:
| Q |
225 |
ccttgagactggtcgcttctggtttcctgctcaagtttataag |
267 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35123224 |
ccttgagactggtcaattctggtttcctgctcaagtttataag |
35123182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 385 - 471
Target Start/End: Complemental strand, 36316071 - 36315985
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| ||| |||| |||| ||||||| |||||||||||| | ||||||||||| |||||| ||||||||||||||| |
|
|
| T |
36316071 |
ccgtgagcatagctcagttggtaggataatgcattattatatgcaggggccggggttcgaacctcggacaccccacttattcacctt |
36315985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 380 - 462
Target Start/End: Complemental strand, 45284893 - 45284811
Alignment:
| Q |
380 |
agtttccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
||||||||||||| || ||| |||||||||||||| | | | |||||||||||| |||||||||||| |||||| |||||| |
|
|
| T |
45284893 |
agtttccgtgagcttagctcagttgatagggacattgaataatttatgcaggggtcggggttcgaaccccggacaccccactt |
45284811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 426 - 467
Target Start/End: Complemental strand, 4956148 - 4956107
Alignment:
| Q |
426 |
tgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
4956148 |
tgcaggggtcggggttcgaaccctggacaccccacttattca |
4956107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 422 - 471
Target Start/End: Original strand, 14707327 - 14707376
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||||| |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
14707327 |
tatatgcaggggttggggttcgaaccccggacaccccacttattcacctt |
14707376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 388 - 469
Target Start/End: Complemental strand, 23685648 - 23685567
Alignment:
| Q |
388 |
tgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacc |
469 |
Q |
| |
|
|||||||| ||| ||||||||| ||||||| |||||||||||| | |||||||||||| ||||| ||||||||||||| |
|
|
| T |
23685648 |
tgagcatagctcagttgataggacaatgcattattatatgcaggggccggggttcgaaccccagacaccccacttattcacc |
23685567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 2291565 - 2291525
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
2291565 |
tatatgcaggggtcggggttcgaacactggacactccactt |
2291525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 381 - 465
Target Start/End: Complemental strand, 8147287 - 8147203
Alignment:
| Q |
381 |
gtttccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttatt |
465 |
Q |
| |
|
||||||||||||||| ||| ||| |||||||||||||| |||||||| ||||| |||| |||||| |||||| |||||||| |
|
|
| T |
8147287 |
gtttccgtgagcatagctcaattggcagggacatgcattgttatatgcaagggtccgggtacgaacctcggacacctcacttatt |
8147203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 19753000 - 19752960
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
19753000 |
tatatgcaggggccggggttcgaaccctggacactccactt |
19752960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 469
Target Start/End: Original strand, 25818284 - 25818368
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacc |
469 |
Q |
| |
|
||||||||||||||| |||| |||| ||||||| |||||||||||| | |||||||||| | |||||||||||||||||| |
|
|
| T |
25818284 |
ccgtgagcataactcagttggtaggataatgcattattatatgcaggggctggagttcgaaccccgaacactccacttattcacc |
25818368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 423 - 471
Target Start/End: Complemental strand, 26606168 - 26606120
Alignment:
| Q |
423 |
atatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||| ||||| | ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26606168 |
atatgtaggggccggggtttgaaccctggacactccacttattcacctt |
26606120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 32834400 - 32834352
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcagggg |
433 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||| |||||||||||| |
|
|
| T |
32834400 |
ccgtgagcataactcaattgataggaacatgcattgttatatgcagggg |
32834352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 33996913 - 33996873
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
33996913 |
tatatgcaggagtcggggttcgaaccctggacactccactt |
33996873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 383 - 471
Target Start/End: Original strand, 46716329 - 46716417
Alignment:
| Q |
383 |
ttccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||| |||||||| ||| |||| |||| ||||||| ||||||||| |||| |||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
46716329 |
ttccatgagcatagctcagttggtaggacaatgcattattatatgcagaggtcggggttcgaaccctgaacaccccacttatttacctt |
46716417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 47440842 - 47440802
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
47440842 |
tatatgcaggggtcggggttcgaaccctggacaccccactt |
47440802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 413 - 476
Target Start/End: Complemental strand, 2567901 - 2567838
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||| || ||| ||||||||| |||||||||| |
|
|
| T |
2567901 |
atgcatttttatatgcaggggccggggttcgaaccccggtcaccccacttattaaccttgaaaa |
2567838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 471
Target Start/End: Original strand, 4169073 - 4169160
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| ||| |||| ||||||| || |||| |||||||| ||| | ||||| |||||| |||||| ||||||||||||||| |
|
|
| T |
4169073 |
ccgtgagcatagctcagttggcagggacaatgtattgttatatgcaagggccggggtttgaaccccggacaccccacttattcacctt |
4169160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 424 - 471
Target Start/End: Original strand, 5228107 - 5228154
Alignment:
| Q |
424 |
tatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||||| | ||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
5228107 |
tatgcaggggccggggttcgaatcctggacaccccacttattcacctt |
5228154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 412 - 471
Target Start/End: Original strand, 14102486 - 14102545
Alignment:
| Q |
412 |
catgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||| |||||||||||| | ||||| |||||| |||||| ||||||||||||||| |
|
|
| T |
14102486 |
catgcattattatatgcaggggccggggtttgaaccccggacaccccacttattcacctt |
14102545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 412 - 471
Target Start/End: Original strand, 14412503 - 14412562
Alignment:
| Q |
412 |
catgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||| |||||||||||| | ||||| |||||| |||||| ||||||||||||||| |
|
|
| T |
14412503 |
catgcattattatatgcaggggccggggtttgaaccccggacaccccacttattcacctt |
14412562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 401 - 476
Target Start/End: Original strand, 16916471 - 16916546
Alignment:
| Q |
401 |
gttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||| ||||||| |||||||||||||| ||||||| |||||||||| |||||| |||||||||| ||| |||| |
|
|
| T |
16916471 |
gttggtagggacttgcattgctatatgtaggggtcggggttcgaacttcggacacctcacttattcagcttaaaaa |
16916546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 413 - 468
Target Start/End: Original strand, 24396971 - 24397026
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||| |||||||||||||| | ||||||||||||||||| | |||||||||| |
|
|
| T |
24396971 |
atgcattattatatgcaggggtcggagttcgaaccctggacaccctacttattcac |
24397026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 468
Target Start/End: Complemental strand, 25711228 - 25711145
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||| ||||||| ||||||||| ||||||| |||||| ||||| | ||||||||||| |||||| |||||||||||| |
|
|
| T |
25711228 |
ccgtgagtataactcagttgataggataatgcattattatatgtaggggccggggttcgaacctcggacaccccacttattcac |
25711145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 467
Target Start/End: Complemental strand, 33202652 - 33202569
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacat-gcattgctatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
|||||| |||||||| |||| |||||||| | |||| ||||| |||||| | |||||||||||| |||||| ||||||||||| |
|
|
| T |
33202652 |
ccgtgaacataactcagttggcagggacattgtattgttatatacaggggccggggttcgaaccccggacaccccacttattca |
33202569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 35498396 - 35498486
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||| |||||||||| |||| ||||||||||||| ||||||||||||| |||||| ||| |||||| |||||||||||| ||||||| |
|
|
| T |
35498396 |
ccgtaagcataactcagttggcagggacatgcattattatatgcaggggt-tgggttcaaacttcggacaccccacttattcactttgaaaa |
35498486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 413 - 471
Target Start/End: Complemental strand, 46337937 - 46337878
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggaca-ctccacttattcacctt |
471 |
Q |
| |
|
||||||| ||||||||||| || |||||||||||||||||| | ||||||||||||||| |
|
|
| T |
46337937 |
atgcattattatatgcagggatcggggttcgaaccctggacacccccacttattcacctt |
46337878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 468
Target Start/End: Original strand, 48053147 - 48053230
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| || |||| ||||||||| |||| |||||| ||||||| || |||||| | ||||||| |||||||||||| |
|
|
| T |
48053147 |
ccgtgagcatagcttagttggtagggacatacattcttatatgtaggggtcgggattcgaatcatggacaccccacttattcac |
48053230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 409 - 476
Target Start/End: Original strand, 48174989 - 48175056
Alignment:
| Q |
409 |
ggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||||| |||||| | | |||||||||| |||||| |||||||||| ||||||||| |
|
|
| T |
48174989 |
ggacatgcattattatatacaggggccggtgttcgaaccccggacaccccacttattccccttgaaaa |
48175056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 385 - 467
Target Start/End: Original strand, 30741562 - 30741643
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
||||||||||||||| |||| |||| ||| |||| |||||||||||| | | |||||||||| |||||| ||||||||||| |
|
|
| T |
30741562 |
ccgtgagcataactcagttggtaggataatgtattgttatatgcaggggccggtgttcgaaccccggacac-ccacttattca |
30741643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 471
Target Start/End: Original strand, 38792238 - 38792296
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||| |||||||||||||||| ||| |||||| |||||| | ||||||||||||| |
|
|
| T |
38792238 |
atgcattattatatgcaggggtcagagtttgaaccccggacaccctacttattcacctt |
38792296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 422 - 468
Target Start/End: Complemental strand, 41417335 - 41417289
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||| |||||||||||| |
|
|
| T |
41417335 |
tatatgcaggggtcggggttcgaaccccagacaccccacttattcac |
41417289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 401 - 474
Target Start/End: Complemental strand, 8903875 - 8903803
Alignment:
| Q |
401 |
gttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaa |
474 |
Q |
| |
|
||||||||||| |||||||| |||||||| || || |||||||||||| ||||| |||||||||| |||||| |
|
|
| T |
8903875 |
gttgatagggatatgcattgttatatgca-ggatcggggttcgaaccccagacacatcacttattcatcttgaa |
8903803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 426 - 467
Target Start/End: Original strand, 31793507 - 31793548
Alignment:
| Q |
426 |
tgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
|||||||||| |||||||||||| |||||| ||||||||||| |
|
|
| T |
31793507 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
31793548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 407 - 476
Target Start/End: Complemental strand, 32309223 - 32309154
Alignment:
| Q |
407 |
agggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||||||| |||||||||||||| | ||||||| | ||||| ||| ||||||||||| |||| |
|
|
| T |
32309223 |
agggacatgcattgttatatgcaggggtcggagttcgaatctcagacaccccagttattcaccttaaaaa |
32309154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 387 - 476
Target Start/End: Complemental strand, 41012676 - 41012587
Alignment:
| Q |
387 |
gtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||| ||| ||| ||||||||||||||| |||||| ||||| | | | |||||||| | ||| ||||||||||||||| |||| |
|
|
| T |
41012676 |
gtgagcatagctcaattggtagggacatgcattgttatatgtaggggccggagctcgaaccccgaacatcccacttattcaccttaaaaa |
41012587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 425 - 462
Target Start/End: Complemental strand, 43119461 - 43119424
Alignment:
| Q |
425 |
atgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
43119461 |
atgcaggggtcggggttcgaaccctggacaccccactt |
43119424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 386 - 467
Target Start/End: Original strand, 47355808 - 47355889
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
||||| ||||| || | ||| ||||| |||||||| |||||||||||| | |||||||||||| |||| ||||||||||| |
|
|
| T |
47355808 |
cgtgaacataattcagatgacagggatatgcattgttatatgcaggggccggggttcgaaccccagacatcccacttattca |
47355889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 386 - 471
Target Start/End: Original strand, 47552212 - 47552297
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||||| ||| |||| |||| ||||||| |||||||| ||| | |||||||||||| |||||| | ||||||||||||| |
|
|
| T |
47552212 |
cgtgagcatagctcagttggtaggacaatgcattattatatgcaagggccggggttcgaaccccggacaccctacttattcacctt |
47552297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 422 - 471
Target Start/End: Original strand, 48525612 - 48525661
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||||| |||||||||||| |||||| |||||||||||||| |
|
|
| T |
48525612 |
tatatgcaggggttggggttcgaaccccggacacctcacttattcacctt |
48525661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 9712230 - 9712190
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||| |||||| |
|
|
| T |
9712230 |
tatatgcaggggtcggggttcgaaccccggacaccccactt |
9712190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 385 - 468
Target Start/End: Complemental strand, 14818463 - 14818379
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| ||| |||| ||||||| |||||| |||||||||||||| |||||| ||||| |||| |||||||||||| |
|
|
| T |
14818463 |
ccgtgagcatagctcagttggcagggacagtgcattattatatgcaggggtcggggttcaaaccccaaacaccccacttattcac |
14818379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 15238927 - 15238967
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
15238927 |
tatatgcaggggccggggttcgaaccccggacactccactt |
15238967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 385 - 468
Target Start/End: Complemental strand, 15265461 - 15265377
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| ||| |||| ||||||| |||||| |||||||||||||| |||||| ||||| |||| |||||||||||| |
|
|
| T |
15265461 |
ccgtgagcatagctcagttggcagggacagtgcattattatatgcaggggtcggggttcaaaccccaaacaccccacttattcac |
15265377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 19828164 - 19828204
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
||||||||| |||| |||||||||||||||| ||||||||| |
|
|
| T |
19828164 |
tatatgcagaggtcggggttcgaaccctggatactccactt |
19828204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 21875660 - 21875620
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| | |||||||||| ||||||||||||| |
|
|
| T |
21875660 |
tatatgcaggggtcggagttcgaaccccggacactccactt |
21875620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 27704331 - 27704291
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
27704331 |
tatatgcaggggttggggttcgaactctggacactccactt |
27704291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 385 - 468
Target Start/End: Complemental strand, 31475938 - 31475854
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacat-gcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| ||| |||| |||||||| ||||| |||||||||||| |||||||||||| ||||| |||||||||||| |
|
|
| T |
31475938 |
ccgtgagcatagctcagttggcagggacattgcattattatatgcaggggctggggttcgaacccctgacaccccacttattcac |
31475854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 35645637 - 35645677
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||| | | |||||||||||||||||||||||||| |
|
|
| T |
35645637 |
tatatgcaggagccggggttcgaaccctggacactccactt |
35645677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 35683159 - 35683119
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| |||||||||| | ||||||||||||| |
|
|
| T |
35683159 |
tatatgcaggggtcggggttcgaactccggacactccactt |
35683119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 35950166 - 35950206
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
35950166 |
tatatgcaggagtcggggttcgaaccccggacactccactt |
35950206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 36391936 - 36391896
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
36391936 |
tatatgcaggagtcggggttcgaaccccggacactccactt |
36391896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 41465872 - 41465912
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| |||||| |
|
|
| T |
41465872 |
tatatgcaggggtcagggttcgaactccggacaccccactt |
41465912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 41833016 - 41832976
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||| |||||| |
|
|
| T |
41833016 |
tatatgcaggggccggggttcgaaccctggacaccccactt |
41832976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 60; Significance: 2e-25; HSPs: 86)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 415 - 482
Target Start/End: Complemental strand, 38129080 - 38129013
Alignment:
| Q |
415 |
gcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaatgatga |
482 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38129080 |
gcattgttatatgcaggggtcggggttcgaaccctggacactccacttattcaccttgaaaatgatga |
38129013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 385 - 478
Target Start/End: Original strand, 28537133 - 28537226
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaatg |
478 |
Q |
| |
|
||||||||||||||| |||| | |||||||||||| |||||||| ||| | |||||||||||| |||||| |||||||||||| ||||||||| |
|
|
| T |
28537133 |
ccgtgagcataactcaattgacatggacatgcattgttatatgcatgggccggggttcgaaccccggacaccccacttattcactttgaaaatg |
28537226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 407 - 476
Target Start/End: Original strand, 31556838 - 31556907
Alignment:
| Q |
407 |
agggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||||||| |||||||||||||| | |||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
31556838 |
agggacatgcattgttatatgcaggggtcggagttcgaaccccggacaccccacttattcaccttgaaaa |
31556907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 42553237 - 42553147
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||| ||||| | ||||||||||| ||||||||||| || |||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
42553237 |
ccgtgagcatagctcagttgacaacgacatgcattgttatatgcaggg-tcggggttcgaaccccggacactacacttattcaccttgaaaa |
42553147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 385 - 482
Target Start/End: Complemental strand, 18102046 - 18101949
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaatgatga |
482 |
Q |
| |
|
||||||||||| ||| |||||||| |||||| ||| |||||||||||| | | |||||||||| ||||| ||||||||||||||| |||||||||| |
|
|
| T |
18102046 |
ccgtgagcatagctcggttgatagagacatgtattattatatgcaggggccggagttcgaaccccagacaccccacttattcaccttaaaaatgatga |
18101949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 407 - 476
Target Start/End: Original strand, 27006360 - 27006429
Alignment:
| Q |
407 |
agggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||| ||||||||| ||||||| |||||| |||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
27006360 |
aggggcatgcattgttatatgctggggtcggggttcgaactccggacactccacttattcaccttgaaaa |
27006429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 388 - 476
Target Start/End: Original strand, 19608614 - 19608702
Alignment:
| Q |
388 |
tgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||| ||| ||||||||| | ||||||| |||||||||||||| |||||||||| | ||||||| |||||||||||||| |||| |
|
|
| T |
19608614 |
tgagcatagctcagttgataggaatatgcattattatatgcaggggtcggggttcgaactccggacacttcacttattcaccttaaaaa |
19608702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 386 - 468
Target Start/End: Complemental strand, 4674912 - 4674829
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
|||||||||| ||| ||||| ||||||| |||||| |||||||||||||| |||||||||||| |||||| |||||||||||| |
|
|
| T |
4674912 |
cgtgagcatagctcagttgacagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcac |
4674829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 385 - 466
Target Start/End: Complemental strand, 35813339 - 35813258
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcagggg-tcagggttcgaaccctggacactccacttattc |
466 |
Q |
| |
|
||||||||||| ||| ||||| |||||||||||||| |||||||||||| ||| ||||||||||| |||||| |||||||||| |
|
|
| T |
35813339 |
ccgtgagcatagctcagttgacagggacatgcattgttatatgcaggggctca-ggttcgaacccaggacaccccacttattc |
35813258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 422 - 471
Target Start/End: Original strand, 20191476 - 20191525
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
20191476 |
tatatgcaggggtcggggttcgaaccccggacactccacttattcacctt |
20191525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 407 - 476
Target Start/End: Original strand, 31907671 - 31907740
Alignment:
| Q |
407 |
agggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||| |||| | |||| |||||||||||||||||||| |
|
|
| T |
31907671 |
agggacatgcattgttatatgcaggggtcatggttcaaacctcgaacaccccacttattcaccttgaaaa |
31907740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 380 - 479
Target Start/End: Complemental strand, 6447583 - 6447483
Alignment:
| Q |
380 |
agtttccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaatg |
478 |
Q |
| |
|
|||| ||||||||||||||| |||| ||||||| |||||| |||||||||||| | ||||||||||| |||||| |||||||||||| || |||||| |
|
|
| T |
6447583 |
agttcccgtgagcataactcagttggcagggacaatgcattattatatgcaggggccggggttcgaacctcggacaccccacttattcactttaaaaatg |
6447484 |
T |
 |
| Q |
479 |
a |
479 |
Q |
| |
|
| |
|
|
| T |
6447483 |
a |
6447483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 385 - 468
Target Start/End: Complemental strand, 6806738 - 6806654
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| ||| |||| || |||| ||||||| |||||||||||||| || ||||||||| ||||||||||||||||||| |
|
|
| T |
6806738 |
ccgtgagcatagctcagttggcagagacaatgcattgttatatgcaggggtcgggattcgaaccccggacactccacttattcac |
6806654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 412 - 476
Target Start/End: Complemental strand, 17137937 - 17137873
Alignment:
| Q |
412 |
catgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||| ||||||||||| || |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
17137937 |
catgcattattatatgcagggatcggggttcgaacccccgacactccacttattcaccttgaaaa |
17137873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 385 - 468
Target Start/End: Original strand, 37303931 - 37304015
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| ||| |||| ||||||| || ||| |||||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
37303931 |
ccgtgagcatagctcagttggcagggacaatgtattattatatgcaggggtcggggttcgaaccctggacaccccacttattcac |
37304015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 401 - 476
Target Start/End: Original strand, 39955014 - 39955090
Alignment:
| Q |
401 |
gttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggaca-ctccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||| ||||||||||||||| |||| |||||||||||||||| ||| ||||| | | |||||||||||||||||||| |
|
|
| T |
39955014 |
gttggtagggacatgcattgttatacgcaggggtcagggttcaaactctggatacccccacttattcaccttgaaaa |
39955090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 3536033 - 3535942
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| || |||| |||||||||||||| ||||| |||| | | |||||||||||| |||||| ||||||||||||||| |||| |
|
|
| T |
3536033 |
ccgtgagcatagttcagttggcagggacatgcattgttatatacaggagccggggttcgaaccccggacaccccacttattcaccttaaaaa |
3535942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 11246591 - 11246500
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||| |||| |||||||||||||| |||||||||||||| ||| || ||||| |||| ||||||||||| |||||||| |
|
|
| T |
11246591 |
ccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggtcggggctcaaaccccagacatcccacttattcagcttgaaaa |
11246500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 17557028 - 17557118
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||| |||||| |||| || ||||||||||| |||||| ||||||| |||||| ||||| |||||| ||||||||||||||| |||| |
|
|
| T |
17557028 |
ccgtgagcctaactcagttggcagagacatgcattgttatatgtaggggtcggggttcaaaccc-ggacaccccacttattcaccttaaaaa |
17557118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 31280476 - 31280386
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||| |||| ||||||||| ||| ||||||||||||| || ||||||||||| | |||| |||||||| ||||||||||| |
|
|
| T |
31280476 |
ccgtgagcatagctcagttggcagggacatgtattactatatgcaggggccaaggttcgaaccccgaacac-ccacttatccaccttgaaaa |
31280386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 385 - 471
Target Start/End: Original strand, 18872519 - 18872605
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| ||| |||| |||| ||||||| |||||||||||||| |||||||||||| | |||| ||||||||||||||| |
|
|
| T |
18872519 |
ccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggtcggggttcgaaccccgaacaccccacttattcacctt |
18872605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 385 - 471
Target Start/End: Complemental strand, 19059101 - 19059015
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| ||| |||| |||| ||||||| ||||||||||| | ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19059101 |
ccgtgagcatagctcagttggtaggacaatgcattatcatatgcaggggccggggttcgaaccctggacaccccacttattcacctt |
19059015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 385 - 471
Target Start/End: Original strand, 33800891 - 33800977
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||||||| |||| |||| ||||||| |||||||||||| | |||||||||||| ||||| ||||||||||||||| |
|
|
| T |
33800891 |
ccgtgagcataactcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccagacaccccacttattcacctt |
33800977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 422 - 471
Target Start/End: Complemental strand, 1244787 - 1244738
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
1244787 |
tatatgcaggggtcagggttcgaaccccagacaccccacttattcacctt |
1244738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 386 - 471
Target Start/End: Original strand, 18478002 - 18478087
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||||| ||| |||| |||| ||||||| ||||||| |||| | ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18478002 |
cgtgagcatagctcagttggtaggacaatgcattattatatgctggggccggggttcgaaccctggacaccccacttattcacctt |
18478087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 386 - 467
Target Start/End: Original strand, 23925542 - 23925623
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||| |||||||||||||| ||||||||| || ||| || ||||||||||| |
|
|
| T |
23925542 |
cgtgagcataactcagttgataggacaatgcattattatatgcaggggtctgggttcgaatcccggataccccacttattca |
23925623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 380 - 468
Target Start/End: Complemental strand, 36045237 - 36045148
Alignment:
| Q |
380 |
agtttccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
|||| ||||||||||| ||| ||||| | | ||| |||||| |||||||||||||| |||||||||||| |||||| |||||||||||| |
|
|
| T |
36045237 |
agttcccgtgagcatagctcagttgacaagaacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcac |
36045148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 387 - 476
Target Start/End: Complemental strand, 41405183 - 41405094
Alignment:
| Q |
387 |
gtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||| || ||||| |||||||||||||| |||||||| ||||| ||||| ||||| ||||||||| |||||||| ||||||| |
|
|
| T |
41405183 |
gtgagcatagttcagttgacagggacatgcattgttatatgcaagggtcggggttggaaccgcagacactccaattattcactttgaaaa |
41405094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 20186864 - 20186953
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||| ||| |||| ||||||||||||| |||||||||||||| ||||| ||||| ||||| |||||||||||||||||||| |
|
|
| T |
20186864 |
ccgtgagcattgctcagttggcagggacatgcattattatatgcaggggtcggggtt--aaccccagacaccccacttattcaccttgaaaa |
20186953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 388 - 476
Target Start/End: Original strand, 38040267 - 38040354
Alignment:
| Q |
388 |
tgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||| ||| |||| |||||||||||||| |||||||||||||| ||||||||| | ||||| ||||||||||| |||||||| |
|
|
| T |
38040267 |
tgagcatagctcagttggcagggacatgcattgttatatgcaggggtcgaggttcgaactc-ggacatcccacttattcatcttgaaaa |
38040354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 393 - 476
Target Start/End: Original strand, 4985765 - 4985848
Alignment:
| Q |
393 |
ataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||| ||| ||| ||||||||||| ||||| ||||||| ||||||||||||||||||| | ||||||||| ||| |||| |
|
|
| T |
4985765 |
ataactcagtttgtagagacatgcattgttatatataggggtcggggttcgaaccctggacaccctacttattcatcttaaaaa |
4985848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 385 - 471
Target Start/End: Original strand, 5156894 - 5156981
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| ||| ||||| | | ||| ||||||| |||||||| |||||| |||||||||||| ||||| | ||||||||||||| |
|
|
| T |
5156894 |
ccgtgagcatagctcagttgacatgaacaatgcattgttatatgcaagggtcaaggttcgaaccctagacaccctacttattcacctt |
5156981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 13862123 - 13862213
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| || ||||| | ||| |||||||| |||||||||||||| | |||||||||| |||||| |||||||||| |||||||| |
|
|
| T |
13862123 |
ccgtgagcatagttcagttgacatggatatgcattgttatatgcaggggtcggagttcgaaccc-ggacaccccacttattcttcttgaaaa |
13862213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 31004227 - 31004136
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||||||| ||| ||||||||| ||||| |||| |||| || ||||| |||||| ||||| |||||||||||||||| |||| |
|
|
| T |
31004227 |
ccgtgagcataactcaattggtagggacatacattgttataggcagaagttggggtttgaaccccggacattccacttattcaccttaaaaa |
31004136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 387 - 468
Target Start/End: Original strand, 1463870 - 1463952
Alignment:
| Q |
387 |
gtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||| ||| |||| ||||||| |||||| |||||||||||| | |||||||||||| |||||| |||||||||||| |
|
|
| T |
1463870 |
gtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
1463952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 385 - 447
Target Start/End: Complemental strand, 7147116 - 7147054
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaacc |
447 |
Q |
| |
|
||||||||||| ||| |||| || ||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
7147116 |
ccgtgagcatagctcagttggtaaggacatgcattattatatgcaggggtcggggttcgaacc |
7147054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 383 - 437
Target Start/End: Original strand, 19648492 - 19648546
Alignment:
| Q |
383 |
ttccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcag |
437 |
Q |
| |
|
||||||||||||| ||| ||||||||||| |||||||| ||||| |||||||||| |
|
|
| T |
19648492 |
ttccgtgagcatagctcagttgatagggaaatgcattgttatatacaggggtcag |
19648546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 386 - 448
Target Start/End: Complemental strand, 22867088 - 22867026
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccc |
448 |
Q |
| |
|
|||||||||||||| ||||| | ||||||||||| |||||||||| |||||| ||||||||| |
|
|
| T |
22867088 |
cgtgagcataactcagttgacaaggacatgcattattatatgcaggagtcaggattcgaaccc |
22867026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 422 - 468
Target Start/End: Original strand, 30733155 - 30733201
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||| ||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
30733155 |
tatatgcagaggtcagggttcgaactccggacactccacttattcac |
30733201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 386 - 476
Target Start/End: Complemental strand, 32253015 - 32252925
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||| |||| ||| ||||||| ||||||||||| |||||| ||||||| |||||||||||| ||||| | | |||||||| ||||||| |
|
|
| T |
32253015 |
cgtgaacatagctcagttgataaggacatgcattattatatgtaggggtcggggttcgaaccccagacacccaatttattcactttgaaaa |
32252925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 385 - 455
Target Start/End: Complemental strand, 36742064 - 36741994
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacac |
455 |
Q |
| |
|
||||||||||| ||| |||| || |||||| |||| ||||||||||| || ||||||||||||||||||| |
|
|
| T |
36742064 |
ccgtgagcatagctcagttggcagagacatgaattgttatatgcagggatcggggttcgaaccctggacac |
36741994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 413 - 471
Target Start/End: Complemental strand, 42455463 - 42455405
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||| |||||||||||| | | |||||||||| |||||||||||||||||||||| |
|
|
| T |
42455463 |
atgcattattatatgcaggggccggagttcgaaccccggacactccacttattcacctt |
42455405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 422 - 471
Target Start/End: Original strand, 10508615 - 10508664
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||||||| || |||||||| ||||||||| ||||||||||||||| |
|
|
| T |
10508615 |
tatatgcaggggccacggttcgaaacctggacaccccacttattcacctt |
10508664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 385 - 466
Target Start/End: Original strand, 25660910 - 25660991
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattc |
466 |
Q |
| |
|
||||||||||| ||| |||| ||||| |||||||| |||||||||||| | || ||||||||| ||||| |||||||||| |
|
|
| T |
25660910 |
ccgtgagcatagctcagttggcagggatatgcattgttatatgcaggggccgggattcgaaccccagacaccccacttattc |
25660991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 422 - 471
Target Start/End: Original strand, 34729507 - 34729555
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
34729507 |
tatatgcaggggtcggggttcgaaccc-ggacaccccacttattcacctt |
34729555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 3497434 - 3497474
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
3497434 |
tatatgcaggggtcggggttcgaaccctggacaccccactt |
3497474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 10905168 - 10905128
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
10905168 |
tatatgcaggggtcggggttcgaaccctggacacttcactt |
10905128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 384 - 476
Target Start/End: Original strand, 39684235 - 39684327
Alignment:
| Q |
384 |
tccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||||| ||| ||| || | |||||||||| |||||| |||||||||| || ||||| ||||| ||||||||||||||| |||| |
|
|
| T |
39684235 |
tccgtgagcatagctcaattggtatgaacatgcattgttatatgtaggggtcaggatttaaaccccggacatcccacttattcaccttaaaaa |
39684327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 402 - 482
Target Start/End: Complemental strand, 42260800 - 42260720
Alignment:
| Q |
402 |
ttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaatgatga |
482 |
Q |
| |
|
|||||| | |||||||||| ||||||||||| || || ||||||| | ||||| ||||||||||||||| |||| ||||| |
|
|
| T |
42260800 |
ttgataagtacatgcattgttatatgcagggttcgggtttcgaactccggacatcccacttattcacctttaaaaagatga |
42260720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 476
Target Start/End: Original strand, 10106632 - 10106719
Alignment:
| Q |
389 |
gagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||| ||| |||| |||||||| |||| |||||| ||||| || |||||||||| |||||| ||||||||||| |||||||| |
|
|
| T |
10106632 |
gagcatagctcagttggcagggacatccattattatatgtaggggccaaagttcgaaccccggacaccccacttattcatcttgaaaa |
10106719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 413 - 468
Target Start/End: Original strand, 10943742 - 10943797
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||| |||||| |||||||||||| |
|
|
| T |
10943742 |
atgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
10943797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 465
Target Start/End: Complemental strand, 14077352 - 14077273
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttatt |
465 |
Q |
| |
|
|||||||||| || ||||| ||||| |||||||| |||||| | | ||||||||||||||| || |||| ||||||||| |
|
|
| T |
14077352 |
cgtgagcatagatcagttgacagggatatgcattgttatatgtaagagtcagggttcgaaccatgaacaccccacttatt |
14077273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 471
Target Start/End: Complemental strand, 843437 - 843379
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||| |||||| ||||| | |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
843437 |
atgcattattatatgtaggggacggggttcgaaccccggacaccccacttattcacctt |
843379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 385 - 471
Target Start/End: Complemental strand, 2029225 - 2029139
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||||||||| |||| |||| ||| ||| |||||||||||||| || ||||||||| | |||| ||||||||||||||| |
|
|
| T |
2029225 |
ccgtgagcataacttagttggtaggacaatgtattattatatgcaggggtcgggattcgaaccccgaacaccccacttattcacctt |
2029139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 385 - 471
Target Start/End: Original strand, 8015833 - 8015919
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| ||| || | |||| ||||||| || ||||||||| | |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
8015833 |
ccgtgagcatatctcagtcggtaggataatgcattattacatgcaggggccggggttcgaaccccggacaccccacttattcacctt |
8015919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 422 - 460
Target Start/End: Original strand, 17666044 - 17666082
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccac |
460 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
17666044 |
tatatgcaggggtcagggttcgaaccccggatactccac |
17666082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 422 - 456
Target Start/End: Original strand, 20224143 - 20224177
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacact |
456 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
20224143 |
tatatgcaggggtcagggttcgaaccccggacact |
20224177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 437 - 471
Target Start/End: Original strand, 20762331 - 20762365
Alignment:
| Q |
437 |
gggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
20762331 |
gggttcgaaccctggacaccccacttattcacctt |
20762365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 385 - 471
Target Start/End: Complemental strand, 20945988 - 20945902
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||||||| ||| |||| ||||||| |||||||||||| | ||||||||| | |||||| ||||||||||||||| |
|
|
| T |
20945988 |
ccgtgagcataactcaattggtaggacaatgcattattatatgcaggggccggggttcgaaatccggacaccccacttattcacctt |
20945902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 471
Target Start/End: Original strand, 24205462 - 24205519
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||| |||||| |||||||||| ||||||||| |||||| ||||||||| ||||| |
|
|
| T |
24205462 |
atgcattgttatatgtaggggtcagg-ttcgaaccccggacaccccacttatttacctt |
24205519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 471
Target Start/End: Complemental strand, 27025498 - 27025440
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||| ||||| |||||| | |||||||||||| ||||| ||||||||||||||| |
|
|
| T |
27025498 |
atgcattgttatattcaggggcctgggttcgaaccccagacaccccacttattcacctt |
27025440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 429 - 471
Target Start/End: Original strand, 29748823 - 29748865
Alignment:
| Q |
429 |
aggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||||||||||||| | |||||| ||||||||||||||| |
|
|
| T |
29748823 |
aggggtcagggttcgaacacaggacaccccacttattcacctt |
29748865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 471
Target Start/End: Complemental strand, 32158483 - 32158425
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||| | |||| ||||||||||||||| |
|
|
| T |
32158483 |
atgcattattatatgcaggggccggggttcgaaccccgaacaccccacttattcacctt |
32158425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 467
Target Start/End: Complemental strand, 42801510 - 42801456
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||| |||||| |||||||||| |
|
|
| T |
42801510 |
atgcattattatatgcaggggtcggggttcgaaccccggacacctcacttattca |
42801456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 425 - 462
Target Start/End: Original strand, 18050220 - 18050257
Alignment:
| Q |
425 |
atgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
18050220 |
atgcaggggtcggggttcgaaccccggacactccactt |
18050257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 429 - 462
Target Start/End: Complemental strand, 18477496 - 18477463
Alignment:
| Q |
429 |
aggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
18477496 |
aggggttagggttcgaaccctggacactccactt |
18477463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 422 - 471
Target Start/End: Complemental strand, 38618741 - 38618692
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||| ||| | |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
38618741 |
tatatgcaagggccggggttcgaaccccggacaccccacttattcacctt |
38618692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 380 - 468
Target Start/End: Complemental strand, 42618516 - 42618427
Alignment:
| Q |
380 |
agtttccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
|||| ||||||||||| ||| |||| ||||||| |||||| ||||| |||||||| ||||||||| || ||| || |||||||||||| |
|
|
| T |
42618516 |
agttcccgtgagcatacctcagttggcagggacaatgcattattatatacaggggtcggggttcgaatcccggataccccacttattcac |
42618427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 407 - 448
Target Start/End: Complemental strand, 42781669 - 42781628
Alignment:
| Q |
407 |
agggacatgcattgctatatgcaggggtcagggttcgaaccc |
448 |
Q |
| |
|
|||||||||||||| ||||||||||| || |||||||||||| |
|
|
| T |
42781669 |
agggacatgcattgttatatgcagggttcggggttcgaaccc |
42781628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 3740992 - 3741032
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||| |||||| |
|
|
| T |
3740992 |
tatatgcaggggtcggggttcgaaccccggacaccccactt |
3741032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 6735821 - 6735781
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| |||||||||||| | ||||||||||| |
|
|
| T |
6735821 |
tatatgcaggggtcggggttcgaaccccgaacactccactt |
6735781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 8149068 - 8149028
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||| |||| |
|
|
| T |
8149068 |
tatatgcagaggtcagggttcgaaacctggacactctactt |
8149028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 392 - 455
Target Start/End: Complemental strand, 9409041 - 9408977
Alignment:
| Q |
392 |
cataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacac |
455 |
Q |
| |
|
|||||||| |||| ||||||| ||||||| |||||||||||||| | |||||||||| |||||| |
|
|
| T |
9409041 |
cataactcagttggcagggacaatgcattgttatatgcaggggtcggagttcgaaccccggacac |
9408977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 11897286 - 11897326
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
11897286 |
tatatgcaggagtcggggttcgaaccccggacactccactt |
11897326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 13958420 - 13958460
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
13958420 |
tatatgcaggggacggggttcgaaccccggacactccactt |
13958460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 17545204 - 17545164
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
17545204 |
tatatgcaggggccggggttcgaaccccggacactccactt |
17545164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 18638636 - 18638676
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
18638636 |
tatatgcaggggccggggttcgaaccccggacactccactt |
18638676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 25729472 - 25729432
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
25729472 |
tatatgcaggggtcggggttcgaaccccagacactccactt |
25729432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 28871356 - 28871316
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| ||||||||| || ||||||||||||| |
|
|
| T |
28871356 |
tatatgcaggggtcggggttcgaatcccggacactccactt |
28871316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 387 - 471
Target Start/End: Complemental strand, 29096403 - 29096319
Alignment:
| Q |
387 |
gtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||| ||| |||| |||| ||||||| |||||||| ||| | | |||||||||| |||||| ||||||||||||||| |
|
|
| T |
29096403 |
gtgagcatagctcagttggtaggacaatgcattattatatgcaagggccggagttcgaaccccggacaccccacttattcacctt |
29096319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 34398495 - 34398535
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
34398495 |
tatatgcaggagtcggggttcgaaccccggacactccactt |
34398535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 35241434 - 35241473
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
35241434 |
tatatgcaggggtcggggttcgaaccct-gacactccactt |
35241473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 36124437 - 36124477
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| ||||||||| || ||||||||||||| |
|
|
| T |
36124437 |
tatatgcaggggtcggggttcgaatcccggacactccactt |
36124477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 423 - 467
Target Start/End: Complemental strand, 36226194 - 36226150
Alignment:
| Q |
423 |
atatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
|||||||| |||| |||||||||||| |||||||||| ||||||| |
|
|
| T |
36226194 |
atatgcagaggtcggggttcgaaccccggacactccatttattca |
36226150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 36888427 - 36888387
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
36888427 |
tatatgcaggagtcggggttcgaaccccggacactccactt |
36888387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 41319483 - 41319443
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| | |||||||||| ||||||||||||| |
|
|
| T |
41319483 |
tatatgcaggggtcggagttcgaaccccggacactccactt |
41319443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 60; Significance: 2e-25; HSPs: 84)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 9768906 - 9768815
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||| |||| |||||||||||||| |||||||||||||| |||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
9768906 |
ccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggtcggggttcgaaccccggacaccccacttattcaccttgaaaa |
9768815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 394 - 476
Target Start/End: Complemental strand, 50199564 - 50199482
Alignment:
| Q |
394 |
taactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||| |||| ||||||||||||||| |||||||||||| | |||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
50199564 |
taactcagttggtagggacatgcattgttatatgcaggggccggggttcgaaccccggacaccccacttattcaccttgaaaa |
50199482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 393 - 476
Target Start/End: Complemental strand, 2903116 - 2903033
Alignment:
| Q |
393 |
ataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||| |||| |||||||||||||| ||||||||| |||| |||||||||||| | |||| |||||||||||||||||||| |
|
|
| T |
2903116 |
ataactcagttgccagggacatgcattgttatatgcagaggtcggggttcgaaccccgaacaccccacttattcaccttgaaaa |
2903033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 385 - 467
Target Start/End: Original strand, 9527423 - 9527506
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
||||||||||| ||| |||| ||||||| ||||||| |||||||||||||| ||||| ||||||||||||| ||||||||||| |
|
|
| T |
9527423 |
ccgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggtcggggtttgaaccctggacaccccacttattca |
9527506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 18003814 - 18003905
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||| |||| |||||||||||||| |||||||||||| | |||||||| ||| | |||| |||||||||||||| ||||| |
|
|
| T |
18003814 |
ccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggccggggttcgagccccgaacaccccacttattcacctggaaaa |
18003905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 413 - 471
Target Start/End: Original strand, 11405482 - 11405540
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
11405482 |
atgcattgttatatgcaggggtcggggttcgaaccccggacaccccacttattcacctt |
11405540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 385 - 471
Target Start/End: Complemental strand, 15774409 - 15774323
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||||||| |||| |||| ||||||| |||||| ||||||| |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
15774409 |
ccgtgagcataactcagttggtaggacaatgcattattatatgtaggggtcggggttcgaaccccggacaccccacttattcacctt |
15774323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 385 - 471
Target Start/End: Complemental strand, 43837498 - 43837412
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| ||| |||| |||| | ||||||| | |||||||||||| ||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
43837498 |
ccgtgagcatagctcagttggtaggaaaatgcattcttctatgcaggggtcggggttcgaaccctggacaccccatttattcacctt |
43837412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 387 - 476
Target Start/End: Original strand, 1721140 - 1721229
Alignment:
| Q |
387 |
gtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||| ||| |||| |||| |||||||||| |||||||||||| | || ||||||||| |||||| |||||||||||||| |||| |
|
|
| T |
1721140 |
gtgagcatagctcagttggtaggaacatgcattgttatatgcaggggccgggtttcgaaccccggacacctcacttattcaccttaaaaa |
1721229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 407 - 476
Target Start/End: Complemental strand, 3341811 - 3341742
Alignment:
| Q |
407 |
agggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||||| |||||||||||| | ||| |||||||| |||||| |||||||||||||||||||| |
|
|
| T |
3341811 |
agggacatgcattattatatgcaggggccggggatcgaaccccggacaccccacttattcaccttgaaaa |
3341742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 476
Target Start/End: Original strand, 12553190 - 12553283
Alignment:
| Q |
384 |
tccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcaggg-ttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||| | ||| |||| |||| |||||||||| |||||||||||| | ||| ||||||||| |||||| |||||||||||| ||||||| |
|
|
| T |
12553190 |
tccgtgagcacagctcagttggtaggaacatgcattgttatatgcaggggccgggggttcgaaccccggacaccccacttattcactttgaaaa |
12553283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 387 - 476
Target Start/End: Original strand, 43020611 - 43020700
Alignment:
| Q |
387 |
gtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||| ||| |||| ||||||||||||| ||||||||||||| ||||||||||| |||||| ||||| |||||||||||||| |
|
|
| T |
43020611 |
gtgagcatagctcggttggcagggacatgcattattatatgcaggggttggggttcgaacctcggacaccccactcattcaccttgaaaa |
43020700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 388 - 476
Target Start/End: Complemental strand, 9769674 - 9769586
Alignment:
| Q |
388 |
tgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||| ||| |||| ||||||||||||| |||||| |||| | |||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
9769674 |
tgagcatagctcagttggcagggacatgcattattatatgtagggattggggttcgaaccccggacaccccacttattcaccttgaaaa |
9769586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 385 - 468
Target Start/End: Original strand, 29491467 - 29491551
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| ||| |||| ||||||| |||||| |||||||||||||| |||||||||||| |||||| |||||||||||| |
|
|
| T |
29491467 |
ccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcac |
29491551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 387 - 471
Target Start/End: Complemental strand, 49251490 - 49251406
Alignment:
| Q |
387 |
gtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||||| |||| |||| ||||||| |||||||||||||| |||||||||||| ||||| ||||||||||||||| |
|
|
| T |
49251490 |
gtgagcataactcagttggtaggacaatgcattattatatgcaggggtcggggttcgaaccccagacaccccacttattcacctt |
49251406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 7906423 - 7906332
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| || |||| ||||||||||||||| |||||||||||| |||||||||||| |||||| || |||||| ||||| |||| |
|
|
| T |
7906423 |
ccgtgagcatagttcagttggtagggacatgcattgttatatgcaggggctggggttcgaacccgggacaccccgcttattgaccttaaaaa |
7906332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 409 - 476
Target Start/End: Complemental strand, 11238101 - 11238034
Alignment:
| Q |
409 |
ggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||| || |||||| ||||||||||| |||||||| |
|
|
| T |
11238101 |
ggacatgcattattatatgcaggggtcggggttcgaatcccggacaccccacttattcatcttgaaaa |
11238034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 389 - 476
Target Start/End: Original strand, 23750152 - 23750239
Alignment:
| Q |
389 |
gagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||| ||| |||| |||||| |||||||| ||||| || ||||| |||||| ||||||| |||| ||||||||||| |||||||| |
|
|
| T |
23750152 |
gagcatagctcagttggtagggatatgcattgttatatacatgggtcggggttcaaaccctgaacaccccacttattcatcttgaaaa |
23750239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 38028535 - 38028626
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||| ||||||||| ||||| | |||||||||||| ||||||| ||| | | ||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
38028535 |
ccgtaagcataacttagttgacaaggacatgcattgttatatgctagggccggagttcgaaccctagacaccccacttattcaccttgaaaa |
38028626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 42908769 - 42908860
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||| || ||| |||| |||||||||||||| |||||||||||||| |||||||||| | ||| || |||||||||| |||||||| |
|
|
| T |
42908769 |
ccgtgagcttagctcagttggcagggacatgcattgttatatgcaggggtcggggttcgaactccggataccccacttattcttcttgaaaa |
42908860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 468
Target Start/End: Complemental strand, 52961179 - 52961096
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| ||| |||| | |||||||||||| |||||||||||| | |||||||||||| |||| | |||||||||||| |
|
|
| T |
52961179 |
ccgtgagcatagctcagttggcaaggacatgcattgttatatgcaggggccggggttcgaaccccggacgccccacttattcac |
52961096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 390 - 448
Target Start/End: Complemental strand, 47141898 - 47141840
Alignment:
| Q |
390 |
agcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccc |
448 |
Q |
| |
|
|||||||||| ||||| |||||||||||||| |||||||||||||| | |||||||||| |
|
|
| T |
47141898 |
agcataactcagttgacagggacatgcattgttatatgcaggggtcggagttcgaaccc |
47141840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 422 - 471
Target Start/End: Original strand, 19424081 - 19424130
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
19424081 |
tatatgcaggggtcggggttcgaaccccggacaccccacttattcacctt |
19424130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 386 - 482
Target Start/End: Original strand, 4288587 - 4288683
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaatgatga |
482 |
Q |
| |
|
|||||||||||||| ||| || |||||| |||| |||||||||||||||| |||||||||| ||||| || ||||||||||| |||| ||||| |
|
|
| T |
4288587 |
cgtgagcataactcaattggtatggacatacattattatatgcaggggtcagagttcgaaccccagacacctcatttattcaccttaaaaaagatga |
4288683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 383 - 467
Target Start/End: Complemental strand, 4429581 - 4429497
Alignment:
| Q |
383 |
ttccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
||||||||||||| ||| |||| |||| ||||||| ||||||||||||| |||||||||||||| ||| |||||||||||| |
|
|
| T |
4429581 |
ttccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggttggggttcgaaccctgaacattccacttattca |
4429497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 416 - 476
Target Start/End: Original strand, 41182803 - 41182863
Alignment:
| Q |
416 |
cattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||| |||||||||||||| ||||| |||||| |||||| |||||||||||| ||||||| |
|
|
| T |
41182803 |
cattgttatatgcaggggtcggggtttgaaccccggacaccccacttattcactttgaaaa |
41182863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 3797853 - 3797944
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||||||| |||| || ||| |||||| |||||| ||||| ||||||||||||| ||||| ||||||||||||||| |||| |
|
|
| T |
3797853 |
ccgtgagcataactcagttggtaaggatatgcataattatatgtaggggctggggttcgaaccctagacaccccacttattcaccttaaaaa |
3797944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 18179326 - 18179417
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||| ||||||||||| | | |||||||||| ||||| | ||||||| ||||||||| |
|
|
| T |
18179326 |
ccgtgagcataactcagttggcagggacatgcattgttatatgcagggaccggagttcgaaccccagacaccctgcttattctccttgaaaa |
18179417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 41677058 - 41677149
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||| || ||| |||| || ||||| |||| ||||||| |||||| |||||||||| | |||||| |||||||||||||||||||| |
|
|
| T |
41677058 |
ccgtgagcgtagctcagttggcagagacattcattattatatgcgggggtcggggttcgaactccggacaccccacttattcaccttgaaaa |
41677149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 48260286 - 48260195
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||| |||| ||||| |||||| |||||| |||||| | |||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
48260286 |
ccgtgagcatagctcagttggcagggatgtgcattattatatgtcggggtcggagttcgaaccccggacaccccacttattcaccttgaaaa |
48260195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 410 - 476
Target Start/End: Original strand, 1660966 - 1661032
Alignment:
| Q |
410 |
gacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||| |||||||||||| | |||||||||||| | |||||||||| |||| ||||||||| |
|
|
| T |
1660966 |
gacatgcattattatatgcaggggccggggttcgaaccccgaacactccactcattctccttgaaaa |
1661032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 385 - 471
Target Start/End: Complemental strand, 18923982 - 18923896
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| ||| |||| |||| ||||||| ||||||||||| |||||||||||||| |||||| |||| |||||||||| |
|
|
| T |
18923982 |
ccgtgagcatagctcagttggtaggacaatgcattattatatgcagggttcagggttcgaacctcggacaccccacgtattcacctt |
18923896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 385 - 467
Target Start/End: Original strand, 19536715 - 19536796
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
|||| |||||| ||| |||| |||||||||||||||||||||| ||||| |||||||||||| ||||| ||||||||||| |
|
|
| T |
19536715 |
ccgtaagcatagctcagttggtagggacatgcattgctatatgtaggggctggggttcgaaccc-ggacatcccacttattca |
19536796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 385 - 471
Target Start/End: Complemental strand, 23930641 - 23930555
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| || |||| |||| ||||||| |||||||||||||| ||||||||||||||||||| ||| ||||| ||||| |
|
|
| T |
23930641 |
ccgtgagcatagttcagttggtaggacaatgcattattatatgcaggggtcggggttcgaaccctggacaccccatttatttacctt |
23930555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 424 - 462
Target Start/End: Complemental strand, 24910508 - 24910470
Alignment:
| Q |
424 |
tatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
24910508 |
tatgcaggggtcagggttcgaaccccggacactccactt |
24910470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 385 - 471
Target Start/End: Original strand, 27745155 - 27745241
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| ||| ||| |||| | ||||||| ||||||||||| || |||||||||||| |||||| ||| ||||||||||| |
|
|
| T |
27745155 |
ccgtgagcatagctcatttggtaggaaaatgcattattatatgcagggatcggggttcgaaccccggacaccccatttattcacctt |
27745241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 378 - 460
Target Start/End: Complemental strand, 47645900 - 47645818
Alignment:
| Q |
378 |
ttagtttccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccac |
460 |
Q |
| |
|
|||||| || |||||||| ||| |||| || ||||||||||| ||||||||| |||| ||||||||| || ||||||||||| |
|
|
| T |
47645900 |
ttagttcccatgagcatagctcagttggcagagacatgcattgttatatgcagaggtcggggttcgaagcccggacactccac |
47645818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 379 - 476
Target Start/End: Complemental strand, 24168682 - 24168585
Alignment:
| Q |
379 |
tagtttccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||| |||||||||||| ||| ||| |||| ||||||||| |||||| |||| | |||||||||||| ||||| ||||||||||||||| |||| |
|
|
| T |
24168682 |
tagtctccgtgagcatagctcagtttgtaggaacatgcattattatatgtagggaccggggttcgaaccccagacaccccacttattcaccttaaaaa |
24168585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 422 - 471
Target Start/End: Original strand, 32635175 - 32635224
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||||| |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
32635175 |
tatatgcaggggttggggttcgaaccccggacaccccacttattcacctt |
32635224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 422 - 471
Target Start/End: Complemental strand, 35195671 - 35195622
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| |||||||||||||| | |||||||||||||||||||| |
|
|
| T |
35195671 |
tatatgcagggaccagggttcgaaccccgtacactccacttattcacctt |
35195622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 8865892 - 8865932
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
8865892 |
tatatgcaggggtcgggattcgaaccctggacactccactt |
8865932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 16304366 - 16304406
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
16304366 |
tatatgcagtggtcagggttcgaaccccggacactccactt |
16304406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 468
Target Start/End: Original strand, 17350058 - 17350142
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||| ||| ||| |||| ||||||| |||||| |||||||||||| | |||||||||||| |||||| |||||||||||| |
|
|
| T |
17350058 |
ccgtgagtatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
17350142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 387 - 471
Target Start/End: Original strand, 19793526 - 19793610
Alignment:
| Q |
387 |
gtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||||| |||| |||| ||||||| |||||||||||| | | ||||||||| |||||| ||||||||||||||| |
|
|
| T |
19793526 |
gtgagcataactcagttggtaggacaatgcattattatatgcaggggccggaattcgaaccccggacaccccacttattcacctt |
19793610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 422 - 470
Target Start/End: Original strand, 25299894 - 25299942
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcacct |
470 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||| ||||||| |
|
|
| T |
25299894 |
tatatgcaggggtcagggttcgtaccctggacaccccactatttcacct |
25299942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 468
Target Start/End: Original strand, 39238713 - 39238797
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| ||| |||| ||||||| |||||| |||||||||||| | ||||||||||| |||||| |||||||||||| |
|
|
| T |
39238713 |
ccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccgaggttcgaaccccggacaccccacttattcac |
39238797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 468
Target Start/End: Original strand, 40678820 - 40678904
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| ||| |||| ||||||| |||||| |||||||||||| | |||||||| ||| |||||| |||||||||||| |
|
|
| T |
40678820 |
ccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgatccccggacaccccacttattcac |
40678904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 2643912 - 2643821
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| || |||| || |||||||||| |||||||| ||||| ||||| |||||| ||||| ||||||||||||||| |||| |
|
|
| T |
2643912 |
ccgtgagcatagcttagttggcagagacatgcattattatatgcatgggtcggggtttgaaccccagacaccccacttattcaccttaaaaa |
2643821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 409 - 476
Target Start/End: Complemental strand, 12048029 - 12047962
Alignment:
| Q |
409 |
ggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||||| ||||||| ||||||||| |||||||||| ||||||||||||| |||| |
|
|
| T |
12048029 |
ggacatgcattattatatataggggtcggggttcgaattctggacactctacttattcaccttaaaaa |
12047962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 409 - 476
Target Start/End: Original strand, 13941341 - 13941408
Alignment:
| Q |
409 |
ggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||||| ||||||||||| || ||||||||| |||||| ||||||||||| |||||||| |
|
|
| T |
13941341 |
ggacatgcattgttatatgcagggttcgaggttcgaacttcggacaccccacttattcatcttgaaaa |
13941408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 422 - 461
Target Start/End: Original strand, 18911889 - 18911928
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccact |
461 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
18911889 |
tatatgcaggggtcagggttcgaaccccggacaccccact |
18911928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 417 - 471
Target Start/End: Original strand, 1031617 - 1031671
Alignment:
| Q |
417 |
attgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||| |||||| ||||||||| |||||||||| | |||| ||||||||||||||| |
|
|
| T |
1031617 |
attgttatatgtaggggtcagagttcgaaccccgaacaccccacttattcacctt |
1031671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 407 - 445
Target Start/End: Original strand, 3569064 - 3569102
Alignment:
| Q |
407 |
agggacatgcattgctatatgcaggggtcagggttcgaa |
445 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
3569064 |
agggacatgcattgttatatgtaggggtcagggttcgaa |
3569102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 379 - 449
Target Start/End: Original strand, 5862120 - 5862190
Alignment:
| Q |
379 |
tagtttccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccct |
449 |
Q |
| |
|
|||||| ||||| |||| ||| |||| |||||||||||||| |||||| || |||| ||||||||||||| |
|
|
| T |
5862120 |
tagttttcgtgaacatagctcagttggcagggacatgcattgttatatgtagaggtcggggttcgaaccct |
5862190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 467
Target Start/End: Original strand, 15368831 - 15368885
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||| |||||| ||||||||||| |
|
|
| T |
15368831 |
atgcattattatatgcaggggccggggttcgaaccccggacaccccacttattca |
15368885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 476
Target Start/End: Complemental strand, 37262205 - 37262113
Alignment:
| Q |
382 |
tttccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||||||| || |||| |||||||||| ||| |||||||| |||||| ||||| ||||| ||| || ||||||||||||||| |||| |
|
|
| T |
37262205 |
tttccgtgagcatagttcagttggcagggacatgcgttgttatatgca-gggtca-ggttcaaaccccggataccccacttattcaccttaaaaa |
37262113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 471
Target Start/End: Original strand, 37733781 - 37733839
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||| ||||||||| || | |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
37733781 |
atgcattattatatgcagtggacggggttcgaaccccggacaccccacttattcacctt |
37733839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 471
Target Start/End: Complemental strand, 50859436 - 50859378
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||| |||||||||||| | |||||| ||||| |||||| |||| |||||||||| |
|
|
| T |
50859436 |
atgcattgatatatgcaggggccggggttcaaaccccggacaccccacatattcacctt |
50859378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 385 - 442
Target Start/End: Original strand, 3140356 - 3140413
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttc |
442 |
Q |
| |
|
||||||| ||||||| ||||| || ||||||||||| |||||| ||||||| |||||| |
|
|
| T |
3140356 |
ccgtgagtataactcagttgacagagacatgcattgttatatgtaggggtcggggttc |
3140413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 388 - 433
Target Start/End: Complemental strand, 4605936 - 4605891
Alignment:
| Q |
388 |
tgagcataactccgttgatagggacatgcattgctatatgcagggg |
433 |
Q |
| |
|
|||||||||||| ||||| || ||||||||||| |||||||||||| |
|
|
| T |
4605936 |
tgagcataactcagttgacagagacatgcattgttatatgcagggg |
4605891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 386 - 471
Target Start/End: Complemental strand, 8364504 - 8364419
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||||||||| |||| |||| | ||||||| |||||| | ||||| | |||||||||| | || | ||||||||||||||| |
|
|
| T |
8364504 |
cgtgagcataactcagttggtaggaaaatgcattattatatgtatgggtcggagttcgaaccccgaacgccccacttattcacctt |
8364419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 422 - 467
Target Start/End: Complemental strand, 14262781 - 14262736
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||| | ||||||||| |
|
|
| T |
14262781 |
tatatgcaggggtcggggttcgaaccccggacaccctacttattca |
14262736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 407 - 476
Target Start/End: Complemental strand, 27655080 - 27655011
Alignment:
| Q |
407 |
agggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||| |||| ||||| ||| |||| || | ||||||| ||||| |||||||||||||||||||| |
|
|
| T |
27655080 |
agggacatgaattgttatatacagaggtctggatacgaaccccagacaccccacttattcaccttgaaaa |
27655011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 385 - 462
Target Start/End: Original strand, 42801877 - 42801954
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||| |||| ||| ||||| || ||||||||||| ||||||||| ||| |||||||||||| ||||| |||||| |
|
|
| T |
42801877 |
ccgtgaacatagctcagttgacagagacatgcattgttatatgcagaggttggggttcgaaccccagacaccccactt |
42801954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 386 - 467
Target Start/End: Original strand, 43327009 - 43327090
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
|||||||||||||| ||| ||||||||| |||| |||||||||||||| ||||||||||| ||| ||||||||||| |
|
|
| T |
43327009 |
cgtgagcataactcagtttgcagggacatgtattgttatatgcaggggtcgaagttcgaaccctaaacatcccacttattca |
43327090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 386 - 471
Target Start/End: Complemental strand, 43555970 - 43555885
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||||| ||| |||| |||| ||||||| ||||||||||| || |||||| ||||| |||||| ||||||||| ||||| |
|
|
| T |
43555970 |
cgtgagcatagctcagttggtaggacaatgcattattatatgcagggatcggggttcaaacccaggacaccccacttatttacctt |
43555885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 411 - 468
Target Start/End: Original strand, 44949524 - 44949581
Alignment:
| Q |
411 |
acatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
|||||||||| |||||| | ||||| |||||||||||||| |||| ||| |||||||| |
|
|
| T |
44949524 |
acatgcattgttatatgtacgggtcggggttcgaaccctgaacaccccatttattcac |
44949581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 422 - 455
Target Start/End: Original strand, 50103899 - 50103932
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacac |
455 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
50103899 |
tatatgtaggggtcagggttcgaaccctggacac |
50103932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 385 - 464
Target Start/End: Complemental strand, 2052780 - 2052700
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttat |
464 |
Q |
| |
|
||||||||||| ||| |||| ||||||| |||||| ||||||||||| | |||||||||||| |||||| |||||||| |
|
|
| T |
2052780 |
ccgtgagcatagctcagttggcagggacaatgcattatcatatgcaggggccggggttcgaaccccggacaccccacttat |
2052700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 387 - 471
Target Start/End: Complemental strand, 4354200 - 4354116
Alignment:
| Q |
387 |
gtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||| ||| |||| |||| ||||||| |||||||||||| | |||||||||| |||||| ||||||||||||||| |
|
|
| T |
4354200 |
gtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaacttcggacaccccacttattcacctt |
4354116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 6463068 - 6463028
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
6463068 |
tatatgcaggggccggggttcgaaccccggacactccactt |
6463028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 13538478 - 13538438
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
13538478 |
tatatgcaggggccggggttcgaaccccggacactccactt |
13538438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 385 - 468
Target Start/End: Complemental strand, 19976650 - 19976566
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| ||| |||| ||||||| || || | |||||||||||| | |||||||||||| |||||| |||| ||||||| |
|
|
| T |
19976650 |
ccgtgagcatagctcagttggcagggacaatgtatggttatatgcaggggccggggttcgaaccccggacaccccacatattcac |
19976566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 22563424 - 22563464
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
22563424 |
tatatgcaggggccggggttcgaaccccggacactccactt |
22563464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 25580726 - 25580766
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
25580726 |
tatatgccggagtcagggttcgaaccctggacacttcactt |
25580766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 30360450 - 30360490
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||| ||||||| |||||||||||| ||||||||||||| |
|
|
| T |
30360450 |
tatatgtaggggtcggggttcgaaccccggacactccactt |
30360490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 32594289 - 32594329
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
32594289 |
tatatgcaggagtcggggttcgaaccccggacactccactt |
32594329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 385 - 468
Target Start/End: Original strand, 35111647 - 35111730
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggac-atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| ||| ||||||||| || ||||||| |||||||||||| | |||||||||||| |||| |||||||||||| |
|
|
| T |
35111647 |
ccgtgagcatagctcagttgataggaacaatgcattattatatgcagggg-cggggttcgaacccctaacaccccacttattcac |
35111730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 385 - 468
Target Start/End: Original strand, 38021249 - 38021333
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| ||| |||| | ||||| |||||| |||||||||||| | | |||||||||| |||||| |||||||||||| |
|
|
| T |
38021249 |
ccgtgagcatagctcagttggcaaggacaatgcattattatatgcaggggccggagttcgaaccccggacaccccacttattcac |
38021333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 41709955 - 41709915
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
41709955 |
tatatgcaggggtcaaggttcgaaccccagacactccactt |
41709915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 42490442 - 42490402
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||| |||||| |
|
|
| T |
42490442 |
tatatgcaggggtcggggttcgaaccccggacaccccactt |
42490402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 43884832 - 43884872
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||| | | |||||||||||||||||||||||||| |
|
|
| T |
43884832 |
tatatgcaggagccggggttcgaaccctggacactccactt |
43884872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 48897149 - 48897109
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| |||||||||||| | ||||||||||||| |
|
|
| T |
48897149 |
tatatgcaggggccagggttcgaacaccggacactccactt |
48897109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 385 - 468
Target Start/End: Complemental strand, 52833204 - 52833120
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
|||||||| |||||| |||| ||||||| |||||| |||||||||||| | |||||||||||| ||||| ||| |||||||| |
|
|
| T |
52833204 |
ccgtgagcctaactcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacatcccatttattcac |
52833120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 54; Significance: 8e-22; HSPs: 91)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 379 - 476
Target Start/End: Original strand, 28951858 - 28951955
Alignment:
| Q |
379 |
tagtttccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||| |||||||||||||||| |||| || ||||||||| ||||||||||||||||||||||||||| | |||| |||||||||||||||||||| |
|
|
| T |
28951858 |
tagtctccgtgagcataactcagttggcagatacatgcattattatatgcaggggtcagggttcgaaccccgaacaccccacttattcaccttgaaaa |
28951955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 24130557 - 24130648
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||||||| |||| |||||||| ||||| |||||||||||| | ||||| |||||| |||||| |||||||||||||||||||| |
|
|
| T |
24130557 |
ccgtgagcataactcagttggcagggacatacattgttatatgcaggggacggggtttgaaccccggacaccccacttattcaccttgaaaa |
24130648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 386 - 468
Target Start/End: Complemental strand, 24160624 - 24160542
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
|||||||||||||| |||| || |||||||| || |||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
24160624 |
cgtgagcataactcagttggcagagacatgcactgttatatgcaggggtcggggttcgaaccccggacactccacttattcac |
24160542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 384 - 478
Target Start/End: Original strand, 3973299 - 3973393
Alignment:
| Q |
384 |
tccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaatg |
478 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||| |||||||||||| | | || |||||| |||||| ||| |||||||||||||||||| |
|
|
| T |
3973299 |
tccgtgagcatagctcagttggtagggacatgcattgttatatgcaggggccgcgatttgaaccccggacaccccatttattcaccttgaaaatg |
3973393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 384 - 478
Target Start/End: Complemental strand, 3996577 - 3996483
Alignment:
| Q |
384 |
tccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaatg |
478 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||| |||||||||||| | | || |||||| |||||| ||| |||||||||||||||||| |
|
|
| T |
3996577 |
tccgtgagcatagctcagttggtagggacatgcattgttatatgcaggggccgcgatttgaaccccggacaccccatttattcaccttgaaaatg |
3996483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 16893542 - 16893451
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||||||| ||||| |||||||| || || ||||| || |||||| |||||||||| |||||| ||||||||| |||||||||| |
|
|
| T |
16893542 |
ccgtgagcataactcagttgacagggacatacactgttatatatagcggtcagagttcgaaccccggacaccccacttatttaccttgaaaa |
16893451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 407 - 482
Target Start/End: Complemental strand, 34407165 - 34407090
Alignment:
| Q |
407 |
agggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaatgatga |
482 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||| ||||| ||||||||||| |||||||||||||| |
|
|
| T |
34407165 |
agggacatgcattattatatgcaggggttggggttcgaaccccagacaccccacttattcatcttgaaaatgatga |
34407090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 378 - 448
Target Start/End: Complemental strand, 3461828 - 3461758
Alignment:
| Q |
378 |
ttagtttccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccc |
448 |
Q |
| |
|
||||| |||||||||||||||| ||||| |||||||||||||| |||||| |||||| |||||||||||| |
|
|
| T |
3461828 |
ttagtctccgtgagcataactcagttgacagggacatgcattgttatatgtaggggttggggttcgaaccc |
3461758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 385 - 471
Target Start/End: Complemental strand, 32508891 - 32508805
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||| |||||| ||||||||| ||||||| |||||||||||||| |||||||||||| | |||| ||||||||||||||| |
|
|
| T |
32508891 |
ccgtgagcctaactcagttgataggataatgcattattatatgcaggggtcggggttcgaaccccgaacaccccacttattcacctt |
32508805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 422 - 471
Target Start/End: Original strand, 27066645 - 27066694
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
27066645 |
tatatgcaggggtcagggttcgaaccccggacaccccacttattcacctt |
27066694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 387 - 476
Target Start/End: Complemental strand, 31108855 - 31108766
Alignment:
| Q |
387 |
gtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||||| |||| |||||||||||| |||||||||||| |||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
31108855 |
gtgagcataactcagttggcagggacatgcataattatatgcaggggctggggttcgaacccgagacaccccacttattcaccttgaaaa |
31108766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 388 - 476
Target Start/End: Original strand, 36842163 - 36842251
Alignment:
| Q |
388 |
tgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||| || || |||||||| |||||||||||| | ||| |||||||||||| ||||||| |
|
|
| T |
36842163 |
tgagcataactcagttgatagggatatgcatttttaaattcaggggtcggggttcgaaccccgtacatcccacttattcactttgaaaa |
36842251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 387 - 478
Target Start/End: Complemental strand, 3993802 - 3993711
Alignment:
| Q |
387 |
gtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaatg |
478 |
Q |
| |
|
||||||||| ||| ||||| |||||||||||||| |||||||||||| | |||| |||||| |||||| ||| |||| ||| ||||||||| |
|
|
| T |
3993802 |
gtgagcatagctcagttgagagggacatgcattgttatatgcaggggccgcggtttgaaccccggacaccccatttatgcactttgaaaatg |
3993711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 387 - 478
Target Start/End: Complemental strand, 4010113 - 4010022
Alignment:
| Q |
387 |
gtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaatg |
478 |
Q |
| |
|
||||||||| ||| |||| ||||||||||||||| |||||||||||| | ||| |||||| | |||| ||| |||||||||||||||||| |
|
|
| T |
4010113 |
gtgagcatagctcagttggtagggacatgcattgttatatgcaggggccgcagtttgaaccccgaacaccccatttattcaccttgaaaatg |
4010022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 401 - 476
Target Start/End: Complemental strand, 4045715 - 4045640
Alignment:
| Q |
401 |
gttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||| ||||||||| |||||| ||||||||||| |||||||| |
|
|
| T |
4045715 |
gttgacagggacatgcattgttatatgcaggggtcgaggttcgaacttcggacaccccacttattcatcttgaaaa |
4045640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 6951887 - 6951797
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||| |||||||||||||| || || ||||| |||||| |||||||||||||| |||| |
|
|
| T |
6951887 |
ccgtgagcataactcagttgacagggacatgcattattatatgcaggggtc-ggatttgaacctcggacaccgcacttattcaccttaaaaa |
6951797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 21249086 - 21248996
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||| |||||| ||| ||||| || |||||| ||| |||||||||||| | |||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
21249086 |
ccgtaagcatagctcagttgacagagacatg-attattatatgcaggggccggggttcgaaccctgaacaccccacttattcaccttgaaaa |
21248996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 471
Target Start/End: Original strand, 43774182 - 43774269
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||| ||| ||| |||| ||||||| ||||||| |||||||||||||| |||||||||||| ||||| ||||||||||||||| |
|
|
| T |
43774182 |
ccgtgagtatagctcagttggcagggacaatgcattgttatatgcaggggtcggggttcgaaccccagacaccccacttattcacctt |
43774269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 424 - 471
Target Start/End: Original strand, 45431664 - 45431711
Alignment:
| Q |
424 |
tatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
45431664 |
tatgcaggggtcagggttcgaaccccggacaccccacttattcacctt |
45431711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 468
Target Start/End: Original strand, 49146082 - 49146165
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
|||||||| |||||| |||| |||| ||||||| |||||||||||||| |||||||||||| |||||| |||||||||||| |
|
|
| T |
49146082 |
ccgtgagcttaactcagttggtaggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcac |
49146165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 385 - 475
Target Start/End: Complemental strand, 11668366 - 11668276
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaa |
475 |
Q |
| |
|
||||||||||||||| ||||| | | ||||| |||| ||||||||| | | ||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
11668366 |
ccgtgagcataactcagttgaaaagaacatgtattgttatatgcagaagccggggttcgaaccacggacaccccacttattcaccttgaaa |
11668276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 415 - 476
Target Start/End: Complemental strand, 22432978 - 22432917
Alignment:
| Q |
415 |
gcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||| |||||||||||| | |||||| ||||| ||||||||||||||||||| ||||||| |
|
|
| T |
22432978 |
gcattgttatatgcaggggccggggttcaaaccccggacactccacttattcactttgaaaa |
22432917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 468
Target Start/End: Complemental strand, 36331825 - 36331740
Alignment:
| Q |
384 |
tccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
|||||||||||| ||| ||| ||||||| |||||| |||||||||||||| |||||||||||| |||||| |||||||||||| |
|
|
| T |
36331825 |
tccgtgagcatagctcaattggcagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcac |
36331740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 407 - 476
Target Start/End: Original strand, 51017810 - 51017878
Alignment:
| Q |
407 |
agggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||||||| |||||||||| ||| | |||||||||| |||||| |||||||||||| ||||||| |
|
|
| T |
51017810 |
agggacatgcattgttatatgcaggagtcggagttcgaaccc-ggacaccccacttattcactttgaaaa |
51017878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 468
Target Start/End: Original strand, 9624980 - 9625064
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| ||| |||| ||||||| |||||| |||||||||||| | |||||||||||| |||||| |||||||||||| |
|
|
| T |
9624980 |
ccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
9625064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 17729029 - 17729069
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
17729029 |
tatatgcaggggtcggggttcgaaccctggacactccactt |
17729069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 19030258 - 19030298
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19030258 |
tatatgcaggggtcggggttcgaaccctggacactccactt |
19030298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 386 - 482
Target Start/End: Original strand, 19149423 - 19149519
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaatgatga |
482 |
Q |
| |
|
||||||||||| || ||||| || |||||||||| |||||| |||| |||||||| |||||| ||||||||| ||||| || ||||||| ||||| |
|
|
| T |
19149423 |
cgtgagcataattcagttgacagagacatgcattattatatgtagggttcagggtttgaaccccagacactccatttatttactttgaaaaagatga |
19149519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 468
Target Start/End: Complemental strand, 27183779 - 27183695
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| ||| |||| ||||||| |||||| |||||||||||| | |||||||||||| |||||| |||||||||||| |
|
|
| T |
27183779 |
ccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
27183695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 380 - 476
Target Start/End: Original strand, 44591993 - 44592088
Alignment:
| Q |
380 |
agtttccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||| |||||||| || ||| |||| |||| |||||||||| |||||||||||||||| |||| || || | ||| || |||||||||||||||||| |
|
|
| T |
44591993 |
agttcccgtgagcttagctcagttggtaggaacatgcattgttatatgcaggggtcagagttcaaaacccgaaca-tctacttattcaccttgaaaa |
44592088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 19137617 - 19137708
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||| |||| ||| |||||||||| |||||||||||| | ||||||||||| ||||| ||| |||||| ||||||||| |
|
|
| T |
19137617 |
ccgtgagcatagctcagttggcaggaacatgcattgttatatgcaggggccgaggttcgaaccccagacaccccatttattctccttgaaaa |
19137708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 409 - 476
Target Start/End: Complemental strand, 31902278 - 31902211
Alignment:
| Q |
409 |
ggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| |||||| ||||||| |||||||||| | |||||| ||||||||||||||| |||| |
|
|
| T |
31902278 |
ggacatgcatttttatatgtaggggtcggggttcgaactccggacaccccacttattcaccttaaaaa |
31902211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 413 - 476
Target Start/End: Complemental strand, 42665994 - 42665931
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||| || ||||||||||| | |||||||| | |||||| |||||||||||||||||||| |
|
|
| T |
42665994 |
atgcattgttaaatgcaggggtcggagttcgaactccggacaccccacttattcaccttgaaaa |
42665931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 386 - 469
Target Start/End: Complemental strand, 50484123 - 50484040
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacc |
469 |
Q |
| |
|
|||||||||||||| |||| ||| ||||||||||| |||| | || || ||| |||||||| || ||||| ||||||||||||| |
|
|
| T |
50484123 |
cgtgagcataactcggttgttagagacatgcattgttatacgtagaggacagagttcgaactctagacaccccacttattcacc |
50484040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 385 - 471
Target Start/End: Complemental strand, 16278048 - 16277962
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| ||| |||| |||| |||||||| |||||||||||||| || ||||||| | ||||| ||||||||||||||| |
|
|
| T |
16278048 |
ccgtgagcatagctcagttggtaggaccatgcattattatatgcaggggtcgggattcgaactccggacatcccacttattcacctt |
16277962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 385 - 471
Target Start/End: Complemental strand, 20623874 - 20623788
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||||||| ||| |||| ||||||| |||||| |||| ||||||||||||| | |||||| ||||||||||||||| |
|
|
| T |
20623874 |
ccgtgagcataactcagtttgtaggacaatgcattattatatgtagggatcagggttcgaactcaggacaccccacttattcacctt |
20623788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 422 - 468
Target Start/End: Original strand, 24559424 - 24559470
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||| |||||||||||| |
|
|
| T |
24559424 |
tatatgcaggggtcggggttcgaaccccggacaccccacttattcac |
24559470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 385 - 471
Target Start/End: Original strand, 33206755 - 33206841
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| ||| |||| |||| ||||||| |||||||||||| |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
33206755 |
ccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggctggggttcgaaccccggacaccccacttattcacctt |
33206841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 385 - 471
Target Start/End: Original strand, 35483267 - 35483353
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| ||| ||| |||| ||||||| |||||||||||||| ||||||||| || |||||| ||||||||||||||| |
|
|
| T |
35483267 |
ccgtgagcatagctcagttagtaggacaatgcattattatatgcaggggtcggggttcgaatcccggacaccccacttattcacctt |
35483353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 386 - 476
Target Start/End: Original strand, 40160734 - 40160824
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||| ||| ||| |||||||||||||| ||||||| |||| ||||| |||||| |||||| ||||||||||||||| |||| |
|
|
| T |
40160734 |
cgtgagcatagctcaattggcagggacatgcattgttatatgccggggctggggtttgaaccccggacaccccacttattcacctttaaaa |
40160824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 385 - 471
Target Start/End: Complemental strand, 42271110 - 42271024
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| ||| |||| |||| |||||||| |||||||||||| | |||||||||| | |||||| | ||||||||||||| |
|
|
| T |
42271110 |
ccgtgagcatagctcagttggtaggacaatgcattgttatatgcaggggccggggttcgaactccggacaccctacttattcacctt |
42271024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 422 - 471
Target Start/End: Original strand, 24537862 - 24537911
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||||||| | |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
24537862 |
tatatgcaggggccggggttcgaaccccggacaccccacttattcacctt |
24537911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 385 - 446
Target Start/End: Original strand, 26583099 - 26583160
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaac |
446 |
Q |
| |
|
|||||| |||||||| |||| ||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
26583099 |
ccgtgatcataactcaattgacagggacatgcattattatatgcaggggtcggggttcgaac |
26583160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 422 - 471
Target Start/End: Original strand, 38414918 - 38414967
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||||||||||||||| |||| ||| |||| ||||||||||||||| |
|
|
| T |
38414918 |
tatatgcaggggtcagggtttgaactctgaacaccccacttattcacctt |
38414967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 380 - 476
Target Start/End: Original strand, 38507641 - 38507735
Alignment:
| Q |
380 |
agtttccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||| ||||||||||| ||| |||| ||||||||||||| ||||| ||||||| |||||| |||||| |||| ||||||||||||||| |||| |
|
|
| T |
38507641 |
agttcccgtgagcatagctcagttggcagggacatgcattattatat--aggggtcggggttcaaaccctaaacaccccacttattcaccttaaaaa |
38507735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 422 - 471
Target Start/End: Complemental strand, 46328984 - 46328935
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||||||| | |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
46328984 |
tatatgcaggggccggggttcgaaccccggacaccccacttattcacctt |
46328935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 422 - 471
Target Start/End: Complemental strand, 54983765 - 54983716
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||| ||| ||||||||||| |
|
|
| T |
54983765 |
tatatgcaggggtcggggttcgaaccccggacaccccatttattcacctt |
54983716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 1697879 - 1697839
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
1697879 |
tatatgcaggggtcagggttcaaaccctggacaccccactt |
1697839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 468
Target Start/End: Complemental strand, 7448461 - 7448377
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggac-atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| ||| |||||||||||| ||||||| |||||||||||| | || ||||||||| || || |||||||||||| |
|
|
| T |
7448461 |
ccgtgagcatagctcagttgatagggacaatgcattattatatgcaggggccgggattcgaaccccagataccccacttattcac |
7448377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 468
Target Start/End: Complemental strand, 7456603 - 7456519
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggac-atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| ||| |||||||||||| ||||||| |||||||||||| | || ||||||||| || || |||||||||||| |
|
|
| T |
7456603 |
ccgtgagcatagctcagttgatagggacaatgcattattatatgcaggggccgggattcgaaccccagataccccacttattcac |
7456519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 468
Target Start/End: Original strand, 14868682 - 14868766
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| ||| |||| ||||||| |||||| |||||||||||| | |||||||||||| | |||| |||||||||||| |
|
|
| T |
14868682 |
ccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccgaacaccccacttattcac |
14868766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 14887268 - 14887308
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
14887268 |
tatatgcaggggtcggggttcgaaccctgtacactccactt |
14887308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 17608351 - 17608311
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
17608351 |
tatatgcaggggccggggttcgaaccctggacactccactt |
17608311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 30779599 - 30779559
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
30779599 |
tatatgcaggggtcggggttcgaaccctggacaccccactt |
30779559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 468
Target Start/End: Original strand, 52030118 - 52030202
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||||||| |||| ||||||| || ||| |||||||||||| | |||||||||||| |||||| | |||||||||| |
|
|
| T |
52030118 |
ccgtgagcataactcagttggcagggacaatgtattattatatgcaggggccggggttcgaaccccggacaccctacttattcac |
52030202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 425 - 460
Target Start/End: Original strand, 6447071 - 6447106
Alignment:
| Q |
425 |
atgcaggggtcagggttcgaaccctggacactccac |
460 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6447071 |
atgcaggggtcagggttcgaaccccggacactccac |
6447106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 476
Target Start/End: Original strand, 33533205 - 33533292
Alignment:
| Q |
389 |
gagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| |||| || ||||||||||| |||||| || ||| ||||||||||| | |||| ||||||||||||||| |||| |
|
|
| T |
33533205 |
gagcataactcagttggcagagacatgcattgttatatgtagtggttggggttcgaaccatagacatcccacttattcaccttaaaaa |
33533292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 424 - 471
Target Start/End: Original strand, 49429497 - 49429544
Alignment:
| Q |
424 |
tatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||| |||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
49429497 |
tatgcagggaccagggttcgaaccccggacaccccacttattcacctt |
49429544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 472
Target Start/End: Original strand, 49639026 - 49639113
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttg |
472 |
Q |
| |
|
||||||||||| ||| |||| |||| ||||||| |||||| ||||| | |||||||||||| | |||| |||||||||||||||| |
|
|
| T |
49639026 |
ccgtgagcatagctcagttggtaggacaatgcattattatatgtaggggccggggttcgaaccccgaacaccccacttattcaccttg |
49639113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 413 - 476
Target Start/End: Original strand, 50724393 - 50724456
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||| |||||| ||||||||||||||| |||| |
|
|
| T |
50724393 |
atgcattattatatgcaggggttggggttcgaacctcggacaccccacttattcaccttaaaaa |
50724456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 413 - 476
Target Start/End: Complemental strand, 50788455 - 50788392
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||| |||||| ||||||||||||||| |||| |
|
|
| T |
50788455 |
atgcattattatatgcaggggttggggttcgaacctcggacaccccacttattcaccttaaaaa |
50788392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 407 - 466
Target Start/End: Complemental strand, 51412065 - 51412006
Alignment:
| Q |
407 |
agggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattc |
466 |
Q |
| |
|
|||||||||||||| |||||||||| ||| ||||||||| || ||| || |||||||||| |
|
|
| T |
51412065 |
agggacatgcattgttatatgcaggagtcggggttcgaatcccggataccccacttattc |
51412006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 389 - 475
Target Start/End: Complemental strand, 794101 - 794016
Alignment:
| Q |
389 |
gagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaa |
475 |
Q |
| |
|
||||||| ||| | |||||| ||||||||||| ||||||| |||| | || ||||||||| |||||| |||||||||| | |||||| |
|
|
| T |
794101 |
gagcatagctcagctgatagagacatgcattgttatatgcgggggccgggattcgaaccccggacac-ccacttattctctttgaaa |
794016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 385 - 447
Target Start/End: Complemental strand, 16874287 - 16874225
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaacc |
447 |
Q |
| |
|
||||||||||| ||| |||| |||||||||||||| |||||||||||| | |||||||||| |
|
|
| T |
16874287 |
ccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggccgaggttcgaacc |
16874225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 407 - 465
Target Start/End: Original strand, 27119296 - 27119354
Alignment:
| Q |
407 |
agggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttatt |
465 |
Q |
| |
|
|||||||||||||| ||||||||| |||| ||||||||| || | |||| ||||||||| |
|
|
| T |
27119296 |
agggacatgcattgttatatgcagaggtcggggttcgaatcccgaacaccccacttatt |
27119354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 422 - 476
Target Start/End: Original strand, 32080090 - 32080144
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||| | ||||| |||||||||||| | |||| |||||||||||||||||||| |
|
|
| T |
32080090 |
tatatgtatgggtcggggttcgaaccccgaacaccccacttattcaccttgaaaa |
32080144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 386 - 471
Target Start/End: Original strand, 41121870 - 41121956
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccac-ttattcacctt |
471 |
Q |
| |
|
|||||||||||||| |||| |||| ||||||| ||||||||| |||| |||||| ||||| |||||| |||| ||||||||||| |
|
|
| T |
41121870 |
cgtgagcataactcagttggtaggacaatgcattattatatgcagaggtcggggttcaaaccccggacaccccactttattcacctt |
41121956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 471
Target Start/End: Complemental strand, 43566865 - 43566807
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||| ||||| ||||||||||||||| |
|
|
| T |
43566865 |
atgcattattatatgcaggggtcggggttcgaacctcagacaccccacttattcacctt |
43566807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 437 - 471
Target Start/End: Complemental strand, 50144651 - 50144617
Alignment:
| Q |
437 |
gggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
50144651 |
gggttcgaaccccggacactccacttattcacctt |
50144617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 411 - 476
Target Start/End: Complemental strand, 4478439 - 4478374
Alignment:
| Q |
411 |
acatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||| || ||||| ||||||||||| ||| |||| |
|
|
| T |
4478439 |
acatgcattattatatgcaggggtcggggttcgaatcccggacatcccacttattcatctttaaaa |
4478374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 385 - 470
Target Start/End: Complemental strand, 16768791 - 16768707
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacct |
470 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||| ||||||||||| | |||| |||||| ||||| |||| ||||||||| |
|
|
| T |
16768791 |
ccgtgagcttaactcaattgatagggacatgcattgtaatatgcagggg-cctggttggaaccccagacaccccacgtattcacct |
16768707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 390 - 447
Target Start/End: Original strand, 24890076 - 24890133
Alignment:
| Q |
390 |
agcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaacc |
447 |
Q |
| |
|
|||||||||| ||||| | |||||||||||| |||||| |||||| ||||||||||| |
|
|
| T |
24890076 |
agcataactcagttgacaaggacatgcattgttatatgtaggggttggggttcgaacc |
24890133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 379 - 428
Target Start/End: Complemental strand, 30745834 - 30745785
Alignment:
| Q |
379 |
tagtttccgtgagcataactccgttgatagggacatgcattgctatatgc |
428 |
Q |
| |
|
||||||||||||||||| ||| |||| |||||||||||||| ||||||| |
|
|
| T |
30745834 |
tagtttccgtgagcatagctcagttggcagggacatgcattgttatatgc |
30745785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 422 - 467
Target Start/End: Original strand, 50381749 - 50381794
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
|||||||||||||| ||||||||| || |||||| ||||||||||| |
|
|
| T |
50381749 |
tatatgcaggggtcggggttcgaatcccggacaccccacttattca |
50381794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 407 - 476
Target Start/End: Original strand, 51493618 - 51493687
Alignment:
| Q |
407 |
agggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||||||| | |||||| ||||| |||||||||||| | || | ||||||| |||||| ||||| |
|
|
| T |
51493618 |
agggacatgcattgttttatgcaagggtcggggttcgaaccccgaacgccccacttaatcacctcgaaaa |
51493687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 439 - 471
Target Start/End: Complemental strand, 335073 - 335041
Alignment:
| Q |
439 |
gttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
335073 |
gttcgaaccctggacaccccacttattcacctt |
335041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 385 - 468
Target Start/End: Original strand, 10959130 - 10959214
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| ||| |||| ||||||| |||||| ||||| ||||| | |||||||||||| |||||| |||||||||||| |
|
|
| T |
10959130 |
ccgtgagcatagctcagttggcagggacaatgcattattatatataggggccggggttcgaaccccggacaccccacttattcac |
10959214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 20243853 - 20243813
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| | ||||||||| |||||||||||||| |
|
|
| T |
20243853 |
tatatgcaggggtcggagttcgaaccttggacactccactt |
20243813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 424 - 468
Target Start/End: Complemental strand, 24136810 - 24136766
Alignment:
| Q |
424 |
tatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
|||||||||| ||||| |||||||| |||||| |||||||||||| |
|
|
| T |
24136810 |
tatgcaggggccagggatcgaaccccggacaccccacttattcac |
24136766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 25884020 - 25883980
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||| |||||| |
|
|
| T |
25884020 |
tatatgcaggggtcggggttcgaaccccggacaccccactt |
25883980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 28193836 - 28193876
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| |||| ||||||| ||||||||||||| |
|
|
| T |
28193836 |
tatatgcaggggtcggggtacgaaccccggacactccactt |
28193876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 28689704 - 28689664
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
28689704 |
tatatgcaggagtcggggttcgaaccccggacactccactt |
28689664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 31528990 - 31528950
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
31528990 |
tatatgcaggagtcggggttcgaaccccggacactccactt |
31528950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 388 - 476
Target Start/End: Complemental strand, 31917961 - 31917873
Alignment:
| Q |
388 |
tgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||| ||| ||| |||| |||||||||| |||||| || |||| || ||||||| |||||| ||||||||||||||| |||| |
|
|
| T |
31917961 |
tgagcatagctcagtttgtaggaacatgcattgttatatgtagaggtcgggcttcgaacttcggacaccccacttattcaccttaaaaa |
31917873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 32732569 - 32732529
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| |||||||||| | ||||||||||||| |
|
|
| T |
32732569 |
tatatgcaggggtcggggttcgaactccggacactccactt |
32732529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 33606971 - 33606932
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
33606971 |
tatatgcaggggtc-gggttcgaaccccggacactccactt |
33606932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 37488492 - 37488452
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
37488492 |
tatatgcaggggccggggttcgaaccccggacactccactt |
37488452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 49194724 - 49194684
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||| ||||| |
|
|
| T |
49194724 |
tatatgtaggggtcagggttcgaaccccggacacttcactt |
49194684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 50659628 - 50659668
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
50659628 |
tatatgcaggggccggggttcgaaccccggacactccactt |
50659668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 51425878 - 51425918
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||| ||||| |
|
|
| T |
51425878 |
tatatgcaggggccggggttcgaaccctggacacttcactt |
51425918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 408 - 476
Target Start/End: Original strand, 55318038 - 55318106
Alignment:
| Q |
408 |
gggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||| |||| || ||| |||||| || ||||||||| |||||| |||||||||||| ||||||| |
|
|
| T |
55318038 |
gggacatgtattgttaaatgtaggggttgggattcgaaccccggacaccccacttattcactttgaaaa |
55318106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 1e-20; HSPs: 79)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 220459 - 220368
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||| |||| ||||||||||| || ||||||||| |||||||||||||| || |||||| |||||||||||||||||||| |
|
|
| T |
220459 |
ccgtgagcatagctcagttggcagggacatgcaatgttatatgcagaggtcagggttcgaatcccggacaccccacttattcaccttgaaaa |
220368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 689614 - 689523
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||| |||| ||||||||||| || ||||||||| |||||||||||||| || |||||| |||||||||||||||||||| |
|
|
| T |
689614 |
ccgtgagcatagctcagttggcagggacatgcaatgttatatgcagaggtcagggttcgaatcccggacaccccacttattcaccttgaaaa |
689523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 734082 - 733991
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||| |||| ||||||||||| || ||||||||| |||||||||||||| || |||||| |||||||||||||||||||| |
|
|
| T |
734082 |
ccgtgagcatagctcagttggcagggacatgcaatgttatatgcagaggtcagggttcgaatcccggacaccccacttattcaccttgaaaa |
733991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 857978 - 857887
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||| |||| ||||||||||| || ||||||||| |||||||||||||| || |||||| |||||||||||||||||||| |
|
|
| T |
857978 |
ccgtgagcatagctcagttggcagggacatgcaatgttatatgcagaggtcagggttcgaatcccggacaccccacttattcaccttgaaaa |
857887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 18577111 - 18577202
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||||||| ||||| ||||||||| |||| |||||||||||||| |||||| ||||| ||| | ||||||||||||||||||| |
|
|
| T |
18577111 |
ccgtgagcataactcagttgacagggacatgtattgttatatgcaggggtcggggttcaaaccccaaacatttcacttattcaccttgaaaa |
18577202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 387 - 476
Target Start/End: Original strand, 17467278 - 17467366
Alignment:
| Q |
387 |
gtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||||| |||| |||||| || |||| |||||||||||| | |||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
17467278 |
gtgagcataactcagttggtagggatatacattattatatgcaggggcc-gggttcgaaccccggacaccccacttattcaccttgaaaa |
17467366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 216244 - 216153
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||| |||| |||||||| ||||| ||||||||| |||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
216244 |
ccgtgagcatagctcagttggcagggacatacattgttatatgcagaggtcagggttcgaatcacggacacctcacttattcaccttgaaaa |
216153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 692804 - 692713
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||| |||| |||||||| ||||| ||||||||| |||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
692804 |
ccgtgagcatagctcagttggcagggacatacattgttatatgcagaggtcagggttcgaatcacggacacctcacttattcaccttgaaaa |
692713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 697013 - 696922
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||| |||| |||||||| ||||| ||||||||| |||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
697013 |
ccgtgagcatagctcagttggcagggacatacattgttatatgcagaggtcagggttcgaatcacggacacctcacttattcaccttgaaaa |
696922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 729867 - 729776
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||| |||| |||||||| ||||| ||||||||| |||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
729867 |
ccgtgagcatagctcagttggcagggacatacattgttatatgcagaggtcagggttcgaatcacggacacctcacttattcaccttgaaaa |
729776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 853762 - 853671
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||| |||| |||||||| ||||| ||||||||| |||||||||||||| | |||||| ||||||||||||||||||| |
|
|
| T |
853762 |
ccgtgagcatagctcagttggcagggacatacattgttatatgcagaggtcagggttcgaatcacggacacctcacttattcaccttgaaaa |
853671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 28979024 - 28979115
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| || |||||||||||||||||||| |||||| ||||||| | ||||||||| |||||| |||||||||||||| |||| |
|
|
| T |
28979024 |
ccgtgagcatagttcagttgatagggacatgcattgttatatgtaggggtcggaattcgaaccccggacacctcacttattcaccttaaaaa |
28979115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 387 - 476
Target Start/End: Original strand, 26657856 - 26657946
Alignment:
| Q |
387 |
gtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggaca-ctccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||| ||| |||| ||||||||||||||| ||||||||||| | |||||||||||| |||| | |||||||||||||||||||| |
|
|
| T |
26657856 |
gtgagcatagctcagttggtagggacatgcattgttatatgcagggaccggggttcgaaccccagacacccccacttattcaccttgaaaa |
26657946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 385 - 474
Target Start/End: Complemental strand, 25470943 - 25470854
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaa |
474 |
Q |
| |
|
||||||||||||||| ||||| ||| ||||||||| ||||| || ||||| ||||||||||| |||||| ||| |||||||||||||| |
|
|
| T |
25470943 |
ccgtgagcataactcagttgacaggaacatgcattattatattcatgggtcggggttcgaacctcggacaccccatttattcaccttgaa |
25470854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 383 - 468
Target Start/End: Complemental strand, 42761964 - 42761879
Alignment:
| Q |
383 |
ttccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||||||||| |||| || | ||||||| |||||||||||| | |||||||||| ||||||||||||||||||||| |
|
|
| T |
42761964 |
ttccgtgagcataactcagttggtatgacaatgcattattatatgcagggggcggggttcgaactctggacactccacttattcac |
42761879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 385 - 468
Target Start/End: Original strand, 2696530 - 2696614
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||||||| |||| ||||||| |||||| |||||||||||| | |||||||||||| |||||| |||||||||||| |
|
|
| T |
2696530 |
ccgtgagcataactcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
2696614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 422 - 477
Target Start/End: Original strand, 574260 - 574314
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaat |
477 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
574260 |
tatatgcaggggtcggggttcgaaccccggacac-ccacttattcaccttgaaaat |
574314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 39432425 - 39432334
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||| |||| ||||||||||| || ||||||||||||| ||||||||||| ||||| |||||||||||| ||||||| |
|
|
| T |
39432425 |
ccgtgagcatagctcagttggcagggacatgcaatgttatatgcaggggttggggttcgaacctcagacaccccacttattcactttgaaaa |
39432334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 385 - 471
Target Start/End: Complemental strand, 3379743 - 3379659
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||| |||||||||||| | |||||||||||| ||||| ||||||||||||||| |
|
|
| T |
3379743 |
ccgtgagcataactcagttgataggataatgcattgttatatgcagggg-ctgggttcgaaccc-cgacaccccacttattcacctt |
3379659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 385 - 471
Target Start/End: Original strand, 8034528 - 8034614
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||| |||||||||| | | |||||||||||| | |||| ||||||||||||||| |
|
|
| T |
8034528 |
ccgtgagcataactccgttaataggacaatgcattattatatgcaggagccggggttcgaaccccgaacaccccacttattcacctt |
8034614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 385 - 471
Target Start/End: Complemental strand, 15042462 - 15042376
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| ||| |||| |||| ||||||| |||||||||||| | |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
15042462 |
ccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcacctt |
15042376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 401 - 482
Target Start/End: Original strand, 35779769 - 35779848
Alignment:
| Q |
401 |
gttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaatgatga |
482 |
Q |
| |
|
|||||||| ||||||||||| |||||||||| || ||||||||||| |||||| ||||||||||| |||||||| ||||| |
|
|
| T |
35779769 |
gttgatagagacatgcattgttatatgcagg--tcggggttcgaacctaggacaccccacttattcatcttgaaaaagatga |
35779848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 385 - 471
Target Start/End: Complemental strand, 43468802 - 43468716
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| ||| |||| |||| |||||||| |||||| ||||||| |||||||||| | |||||| ||||||||||||||| |
|
|
| T |
43468802 |
ccgtgagcatagctcagttggtaggacaatgcattgttatatgtaggggtcggggttcgaactccggacaccccacttattcacctt |
43468716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 413 - 470
Target Start/End: Original strand, 2376544 - 2376601
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacct |
470 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
2376544 |
atgcattattatatgcaggggtccgggttcgaacctcggacactccacttattcacct |
2376601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 468
Target Start/End: Original strand, 2800016 - 2800100
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| ||| |||| ||||||| |||||| |||||||||||| | |||||||||||| |||||| |||||||||||| |
|
|
| T |
2800016 |
ccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
2800100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 387 - 471
Target Start/End: Complemental strand, 7540583 - 7540499
Alignment:
| Q |
387 |
gtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||||| ||| |||| ||||||| |||||||||||||| |||||| ||||||||||| ||||||||||||||| |
|
|
| T |
7540583 |
gtgagcataactcacttggtaggacaatgcattattatatgcaggggtcggggttctaaccctggacaacccacttattcacctt |
7540499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 8265306 - 8265346
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8265306 |
tatatgcaggggtcagggttcgaaccccggacactccactt |
8265346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 413 - 472
Target Start/End: Complemental strand, 4798610 - 4798551
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttg |
472 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||| |||||| |||||||||||||||| |
|
|
| T |
4798610 |
atgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcaccttg |
4798551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 7345426 - 7345517
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||| |||||||||||||| || ||| ||| | |||| ||||||||||||||| |||| |
|
|
| T |
7345426 |
ccgtgagcataactcagttggcagggacatgcattattatatgcaggggtcgggcttccaactccaaacaccccacttattcaccttaaaaa |
7345517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 386 - 467
Target Start/End: Complemental strand, 13537408 - 13537326
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
|||||||||||||| ||||| | | ||| ||||||| |||||||||| ||| |||||||||||| ||||| ||||||||||| |
|
|
| T |
13537408 |
cgtgagcataactcagttgacatgaacaatgcattgttatatgcaggtgtcggggttcgaaccccagacaccccacttattca |
13537326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 386 - 467
Target Start/End: Complemental strand, 13626956 - 13626874
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
|||||||||||||| ||||| | | ||| ||||||| |||||||||| ||| |||||||||||| ||||| ||||||||||| |
|
|
| T |
13626956 |
cgtgagcataactcagttgacatgaacaatgcattgttatatgcaggtgtcggggttcgaaccccagacaccccacttattca |
13626874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 413 - 471
Target Start/End: Complemental strand, 13762581 - 13762523
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||| |||||| ||||||||||||||| |
|
|
| T |
13762581 |
atgcattattatatgcaggggtcagtgttcgaaccacggacaccccacttattcacctt |
13762523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 413 - 471
Target Start/End: Complemental strand, 33570498 - 33570440
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||| |||||||| ||||| ||||||||||| |||||| ||||||||||||||| |
|
|
| T |
33570498 |
atgcattgttatatgcatgggtcggggttcgaacctcggacaccccacttattcacctt |
33570440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 413 - 471
Target Start/End: Complemental strand, 34073308 - 34073250
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||| |||||| |||||||| ||||||||||| |||||| ||||||||||||||| |
|
|
| T |
34073308 |
atgcattattatatgtaggggtcaaggttcgaaccccggacaccccacttattcacctt |
34073250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 422 - 471
Target Start/End: Complemental strand, 5184947 - 5184898
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5184947 |
tatatgcaggggctggggttcgaaccctggacaccccacttattcacctt |
5184898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 407 - 476
Target Start/End: Complemental strand, 22847337 - 22847268
Alignment:
| Q |
407 |
agggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||| |||| |||||||||||||| |||| |
|
|
| T |
22847337 |
agggacatgcattgttatatgcaggggtcgaggttcgaaccccacacacctcacttattcaccttaaaaa |
22847268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 385 - 466
Target Start/End: Original strand, 29937208 - 29937289
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattc |
466 |
Q |
| |
|
||||||||||| ||| |||| |||||||||| |||| |||||||||||| | | ||||||||| ||||| |||||||||| |
|
|
| T |
29937208 |
ccgtgagcatagctcagttggtagggacatgtattgttatatgcaggggccggagttcgaacctcagacaccccacttattc |
29937289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 407 - 476
Target Start/End: Complemental strand, 44254387 - 44254318
Alignment:
| Q |
407 |
agggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||||| ||||||| || ||| |||||||||| ||||||| | |||||||||||||||||| |
|
|
| T |
44254387 |
agggacatgcattattatatgcgggagtcggggttcgaactctggacatcctacttattcaccttgaaaa |
44254318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 377 - 468
Target Start/End: Original strand, 7314722 - 7314814
Alignment:
| Q |
377 |
attagtttccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||| | |||| |||||||||||| | ||||||||||| |||||| |||||||||||| |
|
|
| T |
7314722 |
attagtctccgtgagcataactcaattggcagggacaatacattattatatgcaggggccgaggttcgaaccccggacaccccacttattcac |
7314814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 8862158 - 8862118
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
8862158 |
tatatgcaggggtcagggttcgaactccggacactccactt |
8862118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 31153051 - 31153011
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
31153051 |
tatatgtaggggtcagggttcgaaccctggacaccccactt |
31153011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 424 - 467
Target Start/End: Original strand, 3311477 - 3311520
Alignment:
| Q |
424 |
tatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
||||||||| ||||||||||||||| |||||| ||||||||||| |
|
|
| T |
3311477 |
tatgcagggatcagggttcgaaccccggacaccccacttattca |
3311520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 6325269 - 6325358
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||| |||||||||||||| ||| ||||||||||||| ||||| |||||| ||||| ||||| |||||||||||||| |
|
|
| T |
6325269 |
ccgtgagcata-ctcagttgatagggacatacataattatatgcaggggttggggtttgaaccc-agacaccccactcattcaccttgaaaa |
6325358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 417 - 476
Target Start/End: Original strand, 11172365 - 11172424
Alignment:
| Q |
417 |
attgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||| |||| ||| ||||||| ||| |||| |
|
|
| T |
11172365 |
attgttatatgtaggggtcagggttcgaaccctgaacaccccatttattcaacttaaaaa |
11172424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 378 - 468
Target Start/End: Original strand, 22426391 - 22426482
Alignment:
| Q |
378 |
ttagtttccgtgagcataactccgttgatagggac-atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||| ||||||| |||||| |||||| ||||||||||| ||||| ||| |||||||| |
|
|
| T |
22426391 |
ttagtttccgtgagcataactcaattgacagggacaatgcattattatatgtaggggttgaggttcgaacccctgacaccccatttattcac |
22426482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 401 - 476
Target Start/End: Complemental strand, 26773783 - 26773708
Alignment:
| Q |
401 |
gttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||| |||| ||||||||| ||||||||| |||| | |||||||||| | ||| |||||||||||| ||| |||| |
|
|
| T |
26773783 |
gttgacaggggcatgcattgttatatgcagaggtcggagttcgaaccccgaacattccacttattcatcttaaaaa |
26773708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 432 - 482
Target Start/End: Complemental strand, 4604403 - 4604353
Alignment:
| Q |
432 |
ggtcagggttcgaaccctggacactccacttattcaccttgaaaatgatga |
482 |
Q |
| |
|
|||| |||||||||||| | |||||||||||||||||||| |||| ||||| |
|
|
| T |
4604403 |
ggtcggggttcgaaccccgaacactccacttattcaccttaaaaaagatga |
4604353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 467
Target Start/End: Original strand, 6064403 - 6064457
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||| ||||||| |||||||||| |
|
|
| T |
6064403 |
atgcattattatatgcaggggtcggggttcgaacctcggacacttcacttattca |
6064457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 389 - 471
Target Start/End: Original strand, 6978822 - 6978904
Alignment:
| Q |
389 |
gagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||| || ||||||||| ||||||| ||||||||||||| ||||||||||| | |||||||| ||||||||||| |
|
|
| T |
6978822 |
gagcataattcagttgataggataatgcattattatatgcaggggttggggttcgaaccacgaacactccatttattcacctt |
6978904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 422 - 464
Target Start/End: Original strand, 9370206 - 9370248
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttat |
464 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
9370206 |
tatatgcaggggtcagggttcgaaccccggacacctcacttat |
9370248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 385 - 471
Target Start/End: Original strand, 9524955 - 9525041
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| ||| |||| |||| ||||||| |||||||||||| | |||||||||||| ||||| | ||||||||||||| |
|
|
| T |
9524955 |
ccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccagacaccctacttattcacctt |
9525041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 422 - 468
Target Start/End: Complemental strand, 23178923 - 23178877
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
|||||||||||| | |||||||||||| ||||||||||||| ||||| |
|
|
| T |
23178923 |
tatatgcaggggccggggttcgaaccccggacactccacttcttcac |
23178877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 417 - 471
Target Start/End: Original strand, 23239154 - 23239208
Alignment:
| Q |
417 |
attgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||| |||||| ||||||| ||||| |||||| |||||| ||||||||||||||| |
|
|
| T |
23239154 |
attgttatatgtaggggtcggggtttgaaccccggacaccccacttattcacctt |
23239208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 385 - 471
Target Start/End: Complemental strand, 24608580 - 24608494
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| ||| |||| |||| ||||||| |||||||||||| | |||||||||||| ||||| | ||||||||||||| |
|
|
| T |
24608580 |
ccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccagacaccctacttattcacctt |
24608494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 471
Target Start/End: Original strand, 30542790 - 30542848
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||| ||||||||||| || |||||||||||| | ||| |||| ||||||||||| |
|
|
| T |
30542790 |
atgcattgttatatgcagggatcggggttcgaaccccgaacattccatttattcacctt |
30542848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 471
Target Start/End: Original strand, 37154540 - 37154598
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||| | |||||||||||||| | |||||||||||||||| ||| ||||||||||| |
|
|
| T |
37154540 |
atgcatcgttatatgcaggggtcggaattcgaaccctggacaccccatttattcacctt |
37154598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 422 - 468
Target Start/End: Complemental strand, 39674090 - 39674044
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||| ||||| |
|
|
| T |
39674090 |
tatatgcaggggttggggttcgaaccctggacaccccacttcttcac |
39674044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 471
Target Start/End: Complemental strand, 42762099 - 42762041
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||| ||||||||||||||| ||||| || || |||||| ||||||||||||||| |
|
|
| T |
42762099 |
atgcattactatatgcaggggtcgaggttcaaatcccggacaccccacttattcacctt |
42762041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 385 - 462
Target Start/End: Complemental strand, 43856451 - 43856374
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacat-gcattgctatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||| |||||| |||| |||||| || ||||| |||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
43856451 |
ccgtgagcttaactcagttggtagggatattgcattt-tatatgcaggggccggggttcgaaccccggacactccactt |
43856374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 407 - 476
Target Start/End: Complemental strand, 14011113 - 14011044
Alignment:
| Q |
407 |
agggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||||||| |||||||||||| | | ||||||||| ||||| ||||||||||| ||| |||| |
|
|
| T |
14011113 |
agggacatgcattgttatatgcaggggccggagttcgaacctcggacatcccacttattcatcttaaaaa |
14011044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 422 - 471
Target Start/End: Complemental strand, 19957381 - 19957332
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||||||| | ||||||||||| |||||| ||||||||||||||| |
|
|
| T |
19957381 |
tatatgcaggggacgaggttcgaaccccggacaccccacttattcacctt |
19957332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 386 - 471
Target Start/End: Complemental strand, 26703986 - 26703901
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||||||||| |||| |||| ||||||| |||||||| ||||| ||||||||| || | |||| |||||||||||||| |
|
|
| T |
26703986 |
cgtgagcataactcagttggtaggacaatgcattattatatgcaagggtcggggttcgaatcccgaacacctcacttattcacctt |
26703901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 407 - 476
Target Start/End: Original strand, 29653074 - 29653143
Alignment:
| Q |
407 |
agggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||||| ||||||||||| || ||||||||| | | ||||||||||||||||||| |||| |
|
|
| T |
29653074 |
agggacatgcattattatatgcagggatcgtggttcgaactcctgccactccacttattcaccttaaaaa |
29653143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 385 - 446
Target Start/End: Complemental strand, 32940411 - 32940350
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaac |
446 |
Q |
| |
|
||||||| ||| ||| ||||| |||||||||||||| ||||| |||||||| | |||||||| |
|
|
| T |
32940411 |
ccgtgagtatagctcagttgacagggacatgcattgttatatacaggggtcggagttcgaac |
32940350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 385 - 468
Target Start/End: Complemental strand, 38790671 - 38790586
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcaggg-ttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||||||| |||| ||||||| |||||| |||||||||||| | ||| ||||||||| ||||| |||||||||||| |
|
|
| T |
38790671 |
ccgtgagcataactcagttggcagggacaatgcattattatatgcaggggccgggggttcgaaccccagacaccccacttattcac |
38790586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 422 - 459
Target Start/End: Complemental strand, 41865114 - 41865077
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactcca |
459 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41865114 |
tatatgcaggggtcagggttcgaaccccagacactcca |
41865077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 2792817 - 2792857
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
2792817 |
tatatgcaggggccggggttcgaaccccggacactccactt |
2792857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 2908123 - 2908083
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||| |||||| |
|
|
| T |
2908123 |
tatatgcaggggccggggttcgaaccctggacaccccactt |
2908083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 5332954 - 5332994
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
5332954 |
tatatgcaggagtcggggttcgaaccccggacactccactt |
5332994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 9070757 - 9070717
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
9070757 |
tatatgtaggggtcagggttcgaacctcggacactccactt |
9070717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 385 - 468
Target Start/End: Original strand, 14012609 - 14012693
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| || |||| ||||||| ||||||| |||||||||||| | ||||||||| | |||||| |||||||||||| |
|
|
| T |
14012609 |
ccgtgagcatagttcagttggcagggacaatgcattgttatatgcaggggccggggttcgaagtccggacaccccacttattcac |
14012693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 424 - 468
Target Start/End: Original strand, 17855686 - 17855730
Alignment:
| Q |
424 |
tatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
|||||||||| | |||||||||||| |||||| |||||||||||| |
|
|
| T |
17855686 |
tatgcaggggccggggttcgaaccccggacaccccacttattcac |
17855730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 387 - 471
Target Start/End: Complemental strand, 30942694 - 30942610
Alignment:
| Q |
387 |
gtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||| |||||||| |||||||| ||||||| |||||||||||| | |||||||||||| | |||| ||||||||| ||||| |
|
|
| T |
30942694 |
gtgaacataactcaattgataggacaatgcattattatatgcaggggccggggttcgaaccccgaacaccccacttatttacctt |
30942610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 416 - 468
Target Start/End: Original strand, 33982219 - 33982271
Alignment:
| Q |
416 |
cattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||| |||||||||||||| |||||||||||| ||||| ||||||||||| |
|
|
| T |
33982219 |
cattgttatatgcaggggtcggggttcgaaccccagacaccgcacttattcac |
33982271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 38219600 - 38219560
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
38219600 |
tatatgcaggagtcggggttcgaaccccggacactccactt |
38219560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 39587585 - 39587625
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
||||| |||||||| || ||||||||||||||||||||||| |
|
|
| T |
39587585 |
tatattcaggggtcgggattcgaaccctggacactccactt |
39587625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 40362086 - 40362126
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
40362086 |
tatatgcaggggtcggggttcgaacctcggacactccactt |
40362126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 43085255 - 43085215
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
43085255 |
tatatgcaggggccggggttcgaaccccggacactccactt |
43085215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 44673680 - 44673640
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
44673680 |
tatatgcaggggtcggggttcgaaccccagacactccactt |
44673640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 52; Significance: 1e-20; HSPs: 101)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 33359815 - 33359906
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||| ||||| | |||||| ||||| |||||||| ||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33359815 |
ccgtgagcatagctcagttgacatggacattcattgttatatgcaagggtcgaggttcgaaccctggacaccccacttattcaccttgaaaa |
33359906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 387 - 482
Target Start/End: Complemental strand, 42758258 - 42758164
Alignment:
| Q |
387 |
gtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaatgatga |
482 |
Q |
| |
|
||||||||| ||| ||| |||||||||||||| |||||||||||| | ||||||||||||||||||| ||||||||||||||| |||| ||||| |
|
|
| T |
42758258 |
gtgagcatagctcagtttgtagggacatgcattattatatgcaggggcc-gggttcgaaccctggacaccccacttattcaccttcaaaaagatga |
42758164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 49039542 - 49039451
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||| |||| |||||||||||||| ||||||||||| |||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
49039542 |
ccgtgagcatagctcagttggcagggacatgcattgttatatgcagggactggggttcgaaccccggacaccccacttattcaccttgaaaa |
49039451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 389 - 475
Target Start/End: Complemental strand, 35230388 - 35230302
Alignment:
| Q |
389 |
gagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaa |
475 |
Q |
| |
|
||||||| ||| |||| |||||| ||||||||||||||||| ||||| ||||||||||| |||||| ||||||||| ||||||||| |
|
|
| T |
35230388 |
gagcatagctcagttggtagggatatgcattgctatatgcatgggtcggggttcgaacctcggacaccccacttatttaccttgaaa |
35230302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 386 - 476
Target Start/End: Original strand, 49319392 - 49319482
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||| ||| |||| | ||||||||||| |||||||||||||| |||||| ||||| |||||| |||||||||||||||||||| |
|
|
| T |
49319392 |
cgtgagcatagctcagttggcatggacatgcattattatatgcaggggtcggggttccaaccccggacaccccacttattcaccttgaaaa |
49319482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 385 - 471
Target Start/End: Complemental strand, 12820503 - 12820416
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| ||| |||| || |||| ||||||| |||||||||||||| ||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
12820503 |
ccgtgagcatagctcagttggcagagacaatgcattgttatatgcaggggtcggggttagaaccctggacaccccacttattcacctt |
12820416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 41492595 - 41492505
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||| |||| ||||||||||||| |||||||||||| | ||||||||| ||||||||| ||||||||| |||||||||| |
|
|
| T |
41492595 |
ccgtgagcatagctcagttggcagggacatgcattattatatgcaggggccggggttcgaa-cctggacaccccacttatttaccttgaaaa |
41492505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 422 - 472
Target Start/End: Original strand, 9924891 - 9924941
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcaccttg |
472 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9924891 |
tatatgcaggggtcggggttcgaaccccggacactccacttattcaccttg |
9924941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 387 - 476
Target Start/End: Original strand, 20610739 - 20610828
Alignment:
| Q |
387 |
gtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||| ||| |||| |||||||||||||| |||||||||||| | |||||||||| | ||||| ||||||||||||||| |||| |
|
|
| T |
20610739 |
gtgagcatagctcagttggcagggacatgcattgttatatgcaggggccggggttcgaactccggacatcccacttattcaccttaaaaa |
20610828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 408 - 476
Target Start/End: Original strand, 33076551 - 33076619
Alignment:
| Q |
408 |
gggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||| |||||| | ||||||||||||| |||| |
|
|
| T |
33076551 |
gggacatgcattattatatgcaggggtcggggttcgaaccccggacaccctacttattcaccttaaaaa |
33076619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 471
Target Start/End: Original strand, 36008272 - 36008359
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| ||| |||| ||||||| ||||||| |||||||||||| | |||||||||||| | |||| ||||||||||||||| |
|
|
| T |
36008272 |
ccgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggccggggttcgaaccccgaacaccccacttattcacctt |
36008359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 471
Target Start/End: Original strand, 48512196 - 48512283
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| ||| |||| ||||||| ||||||| |||||||||||| |||||||| |||| |||||| ||||||||||||||| |
|
|
| T |
48512196 |
ccgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggctagggttcgtaccccggacaccccacttattcacctt |
48512283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 386 - 476
Target Start/End: Complemental strand, 4419782 - 4419692
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||| |||||||||||| | |||||| ||||| | |||| || |||||||||||||||| |
|
|
| T |
4419782 |
cgtgagcataactcagttgtcagagacatgcattgttatatgcaggggccggggttcaaacccagaacacctcatttattcaccttgaaaa |
4419692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 385 - 471
Target Start/End: Complemental strand, 47018043 - 47017957
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| ||| |||| |||| ||||||| |||||||||||| | |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
47018043 |
ccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcacctt |
47017957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 387 - 476
Target Start/End: Complemental strand, 56955 - 56866
Alignment:
| Q |
387 |
gtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| |||||||| ||| | | |||||||| | | |||| ||| |||||||||||||||| |
|
|
| T |
56955 |
gtgagcataactcagttggcagggacatgcattgttatatgcaagggccggagttcgaactccgaacaccccatttattcaccttgaaaa |
56866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 422 - 471
Target Start/End: Original strand, 1297888 - 1297937
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||||||||| || ||||||||||| |||||||||||||||||||| |
|
|
| T |
1297888 |
tatatgcaggggtcgggattcgaaccctgaacactccacttattcacctt |
1297937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 387 - 476
Target Start/End: Complemental strand, 52556770 - 52556681
Alignment:
| Q |
387 |
gtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||| |||| ||| ||||||||| |||| ||||| |||||||||||||| |||||||||| | ||||||||||||||| |||| |||| |
|
|
| T |
52556770 |
gtgaacatagctcagttgataggaacatacattgttatatgcaggggtcggggttcgaacatcgaacactccacttattctccttaaaaa |
52556681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 7513413 - 7513373
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7513413 |
tatatgcaggggtcagggttcgaaccccggacactccactt |
7513373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 468
Target Start/End: Complemental strand, 28520829 - 28520745
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| ||| |||| ||||||| |||||| |||||||||||| | |||||||||||| |||||| |||||||||||| |
|
|
| T |
28520829 |
ccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
28520745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 412 - 476
Target Start/End: Original strand, 30203278 - 30203342
Alignment:
| Q |
412 |
catgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||| ||||||||| || | |||||||||||| ||| |||||||||||||| |||||||| |
|
|
| T |
30203278 |
catgcattgttatatgcagaggccggggttcgaaccccggatactccacttattcatcttgaaaa |
30203342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 383 - 471
Target Start/End: Original strand, 32885684 - 32885772
Alignment:
| Q |
383 |
ttccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||||| ||| |||| |||| ||||||| |||||||||||||| | ||||||||| |||||| ||||||||||||||| |
|
|
| T |
32885684 |
ttccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggtcggagttcgaacctcggacaccccacttattcacctt |
32885772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 39023213 - 39023253
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39023213 |
tatatgcaggggtcggggttcgaaccctggacactccactt |
39023253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 413 - 468
Target Start/End: Original strand, 8690240 - 8690295
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||| |||||| |||||||||||| |
|
|
| T |
8690240 |
atgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcac |
8690295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 15185076 - 15185167
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| || |||| ||||| |||||||| |||||||||||||| ||||| ||| ||||||||| | ||| |||| ||||||||| |
|
|
| T |
15185076 |
ccgtgagcatagttcggttggcagggatatgcattgttatatgcaggggtcggggtttgaatcctggacaccctactcattctccttgaaaa |
15185167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 20166314 - 20166405
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||| || ||| |||| |||||||||||||| |||||||||||| | ||||||||||| || || |||||||||| ||||||||| |
|
|
| T |
20166314 |
ccgtgagcgtagctcagttggcagggacatgcattgttatatgcaggggccgaggttcgaaccccagataccccacttattctccttgaaaa |
20166405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 385 - 448
Target Start/End: Original strand, 27921894 - 27921957
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccc |
448 |
Q |
| |
|
||||||||||| ||| |||| |||||||||||||| |||||||||||| | |||||||||||| |
|
|
| T |
27921894 |
ccgtgagcatagctcagttggtagggacatgcattattatatgcaggggccggggttcgaaccc |
27921957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 29785148 - 29785239
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||| |||| |||||||| || || ||||| ||||| |||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
29785148 |
ccgtgagcatagctcagttggcagggacatacactgtaatatgtaggggctggggttcgaaccccggacaccccacttattcaccttgaaaa |
29785239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 411 - 482
Target Start/End: Original strand, 54264952 - 54265023
Alignment:
| Q |
411 |
acatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaatgatga |
482 |
Q |
| |
|
|||||||||| |||||| |||||||||||||| |||| | |||| ||||||||||||||||||| ||||| |
|
|
| T |
54264952 |
acatgcattgttatatgtaggggtcagggttcaaacctcgaacacctcacttattcaccttgaaaaagatga |
54265023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 54854276 - 54854185
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||| |||| |||||||||||| |||||||||||| |||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
54854276 |
ccgtgagcatagctcagttggcagggacatgcataattatatgcaggggctggggttcgaaccccggacatcacacttattcaccttgaaaa |
54854185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 410 - 476
Target Start/End: Complemental strand, 1589229 - 1589163
Alignment:
| Q |
410 |
gacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||| ||||| ||| ||||||| ||| |||| |
|
|
| T |
1589229 |
gacatgcattgttatatgcaggggtcaggattcgaaccccggacatcccatttattcatcttaaaaa |
1589163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 385 - 471
Target Start/End: Original strand, 3465581 - 3465667
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||| |||||||||| |||| |||| ||||||| |||||||||||| | | |||||||||| |||||| ||||||||||||||| |
|
|
| T |
3465581 |
ccgtaagcataactcagttggtaggacaatgcattattatatgcaggggccggagttcgaaccccggacaccccacttattcacctt |
3465667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 413 - 467
Target Start/End: Complemental strand, 13211421 - 13211367
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
||||||| |||||||| ||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
13211421 |
atgcattattatatgcatgggtcggggttcgaaccccggacactccacttattca |
13211367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 385 - 471
Target Start/End: Complemental strand, 20753222 - 20753136
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| ||| |||| |||| | ||||||| |||||| ||||| | |||||||||||| |||||| |||||||||||||| |
|
|
| T |
20753222 |
ccgtgagcatagctcagttggtaggaaaatgcattattatatgtaggggccggggttcgaaccccggacaccacacttattcacctt |
20753136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 413 - 471
Target Start/End: Complemental strand, 37032248 - 37032190
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||| |||||||||||||| || ||||||||| |||||| ||||||||||||||| |
|
|
| T |
37032248 |
atgcattattatatgcaggggtcgggattcgaaccccggacaccccacttattcacctt |
37032190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 385 - 465
Target Start/End: Original strand, 2565258 - 2565339
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttatt |
465 |
Q |
| |
|
||||||||||| ||| ||||| ||||||| ||||||| |||||||||||||| | ||||||| || | |||| ||||||||| |
|
|
| T |
2565258 |
ccgtgagcatagctcagttgacagggacaatgcattgttatatgcaggggtcggagttcgaatcccgaacaccccacttatt |
2565339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 384 - 465
Target Start/End: Original strand, 15853819 - 15853900
Alignment:
| Q |
384 |
tccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttatt |
465 |
Q |
| |
|
||||||||||||| || |||| ||| |||||||||| ||||| |||||| ||||||||||||||||||| ||| ||||| |
|
|
| T |
15853819 |
tccgtgagcataattcagttggcaggaacatgcattgttatatacaggggctggggttcgaaccctggacaccccagttatt |
15853900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 388 - 445
Target Start/End: Original strand, 17431378 - 17431435
Alignment:
| Q |
388 |
tgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaa |
445 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| ||||||||| || | ||||||||| |
|
|
| T |
17431378 |
tgagcataactcagttgacagggacatgcattgttatatgcagaggcccgggttcgaa |
17431435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 422 - 471
Target Start/End: Original strand, 38690701 - 38690750
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||| |||||||||| |||| |
|
|
| T |
38690701 |
tatatgcaggggtcggggttcgaaccccggacaccccacttattctcctt |
38690750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 385 - 465
Target Start/End: Complemental strand, 42411552 - 42411471
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttatt |
465 |
Q |
| |
|
||||||||||| ||| |||| ||||||| ||||| |||||||||||||| |||||||||||| |||||| ||||||||| |
|
|
| T |
42411552 |
ccgtgagcatagctcagttggcagggacaatgcataattatatgcaggggtcggggttcgaaccccggacaccccacttatt |
42411471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 7686294 - 7686254
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
7686294 |
tatatgcaggggccggggttcgaaccctggacactccactt |
7686254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 388 - 467
Target Start/End: Original strand, 9084759 - 9084839
Alignment:
| Q |
388 |
tgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
|||||||| ||| |||| ||||||| ||||||| |||||||||||||| || |||||||| |||||| ||||||||||| |
|
|
| T |
9084759 |
tgagcatagctcagttggcagggacaatgcattgttatatgcaggggtcgggattcgaacctcggacaccccacttattca |
9084839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 468
Target Start/End: Original strand, 9692959 - 9693043
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| ||| |||| ||||| | |||||| |||||||||||| | |||||||||||| |||||| |||||||||||| |
|
|
| T |
9692959 |
ccgtgagcatagctcagttggcagggataatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
9693043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 10417253 - 10417213
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
10417253 |
tatatgcaggagtcagggttcgaaccccggacactccactt |
10417213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 12775271 - 12775231
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12775271 |
tatatgcaggggtcagggttcgaattctggacactccactt |
12775231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 383 - 471
Target Start/End: Original strand, 12856180 - 12856268
Alignment:
| Q |
383 |
ttccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||||| ||| |||| |||| ||||| | |||||| ||||||| | |||||||||| |||||| ||||||||||||||| |
|
|
| T |
12856180 |
ttccgtgagcatagctcagttggtaggataatgcactattatatgaaggggtcggagttcgaaccccggacaccccacttattcacctt |
12856268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 468
Target Start/End: Original strand, 14149790 - 14149874
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
|||||| |||| ||| |||| ||||||| |||||| |||||||||||| | |||||||||||| |||||| |||||||||||| |
|
|
| T |
14149790 |
ccgtgaccatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
14149874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 408 - 476
Target Start/End: Original strand, 18497413 - 18497481
Alignment:
| Q |
408 |
gggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||| | ||||| |||||||||| |||| |||| |
|
|
| T |
18497413 |
gggacatgcattgttatatgcaggggttggggttcgaactccggacatcccacttattctccttaaaaa |
18497481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 386 - 476
Target Start/End: Original strand, 24039887 - 24039973
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||| ||| ||||| ||| |||||||||| |||||| ||||| |||||||||||| | |||| ||||||||||||||||||| |
|
|
| T |
24039887 |
cgtgagcatagctcagttgacagg-acatgcattgttatatg---gggtcggggttcgaaccccgaacacctcacttattcaccttgaaaa |
24039973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 468
Target Start/End: Complemental strand, 48968308 - 48968224
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| || |||| ||||||| |||||| |||||||||||| | |||||||||||| |||||| |||||||||||| |
|
|
| T |
48968308 |
ccgtgagcatagttcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
48968224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 380 - 448
Target Start/End: Complemental strand, 48991968 - 48991900
Alignment:
| Q |
380 |
agtttccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccc |
448 |
Q |
| |
|
||||||||| |||||||||| ||||| ||| |||| ||||| |||||||| ||| | |||||||||||| |
|
|
| T |
48991968 |
agtttccgtaagcataactcagttgacaggaacatacattgttatatgcaagggccggggttcgaaccc |
48991900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 50457746 - 50457706
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
50457746 |
tatatgcaggggccagggttcgaaccccggacactccactt |
50457706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 468
Target Start/End: Original strand, 53815693 - 53815777
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| ||| |||| ||||||| |||||| |||||||||||| |||||||||||| |||||| |||||||||||| |
|
|
| T |
53815693 |
ccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggctggggttcgaaccccggacaccccacttattcac |
53815777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 410 - 478
Target Start/End: Original strand, 55967601 - 55967669
Alignment:
| Q |
410 |
gacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaatg |
478 |
Q |
| |
|
||||||||||| |||||||||||| || ||||||||| |||||| |||||||||| | ||||||||| |
|
|
| T |
55967601 |
gacatgcattgttatatgcaggggacaaaattcgaaccccggacaccccacttattcgcattgaaaatg |
55967669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 401 - 476
Target Start/End: Complemental strand, 23226786 - 23226711
Alignment:
| Q |
401 |
gttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||| |||||||||||||| |||||||||| || |||||||||| | ||||| |||||||||||||| |||| |
|
|
| T |
23226786 |
gttgacagggacatgcattgttatatgcaggagttggggttcgaacaccggacatctcacttattcaccttaaaaa |
23226711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 468
Target Start/End: Original strand, 36257692 - 36257775
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| ||| |||| ||||||| ||| | | |||||||||| | |||||||||||| |||||| |||||||||||| |
|
|
| T |
36257692 |
ccgtgagcatagctcagttggcagggacaagcagtattgtatgcaggggccggggttcgaaccccggacaccccacttattcac |
36257775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 413 - 468
Target Start/End: Original strand, 36954163 - 36954218
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||| |||||| ||| |||||||| |
|
|
| T |
36954163 |
atgcattattatatgcaggggtcggggttcgaaccccggacaccccatttattcac |
36954218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 407 - 482
Target Start/End: Complemental strand, 37997921 - 37997846
Alignment:
| Q |
407 |
agggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaatgatga |
482 |
Q |
| |
|
|||||||| ||||| ||||||||||| |||||||||||| ||||| ||||||||||||||| |||| ||||| |
|
|
| T |
37997921 |
agggacattcattgttatatgcagggtctggggttcgaaccccagacaccccacttattcaccttaaaaaggatga |
37997846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 413 - 468
Target Start/End: Original strand, 52031233 - 52031288
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||| ||||| |||||||||||| |
|
|
| T |
52031233 |
atgcattagtatatgcaggggtcggggttcgaaccccagacaccccacttattcac |
52031288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 413 - 468
Target Start/End: Original strand, 56314787 - 56314842
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
56314787 |
atgcattattatatgcaggggtcagggttcgaaccacggacaccacacttattcac |
56314842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 386 - 476
Target Start/End: Original strand, 6202602 - 6202692
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||| |||||| |||| || ||||||| ||| | |||| ||||| ||||||||||||| |||||| | ||||||||| |||||||| |
|
|
| T |
6202602 |
cgtgagcttaactcagttggcagcgacatgctttgttttatgtaggggctagggttcgaaccccggacaccctacttattcatcttgaaaa |
6202692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 385 - 447
Target Start/End: Complemental strand, 9172468 - 9172406
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaacc |
447 |
Q |
| |
|
||||||||||||||| |||| |||| ||||||| |||||||||||||| ||||||||||| |
|
|
| T |
9172468 |
ccgtgagcataactcagttggtaggacaatgcattattatatgcaggggtcggggttcgaacc |
9172406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 424 - 462
Target Start/End: Original strand, 23695124 - 23695162
Alignment:
| Q |
424 |
tatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
23695124 |
tatgcaggggtcagggttcgaaccccggacaccccactt |
23695162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 385 - 467
Target Start/End: Complemental strand, 24234171 - 24234089
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
||||||||||| ||| |||| |||| ||||||| |||||||||||| | ||||| |||||| |||||| ||||||||||| |
|
|
| T |
24234171 |
ccgtgagcatagctcagttggtaggtcaatgcattattatatgcaggggccggggtttgaaccccggacaccccacttattca |
24234089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 422 - 468
Target Start/End: Original strand, 26253987 - 26254033
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
|||||||||||||| | ||||||| || ||||||||||||||||||| |
|
|
| T |
26253987 |
tatatgcaggggtcggagttcgaatcccggacactccacttattcac |
26254033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 385 - 467
Target Start/End: Complemental strand, 33944460 - 33944378
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
||||||||||||||| |||| |||| ||||||| |||||||||||| | ||||||||||| | | |||||||||||||| |
|
|
| T |
33944460 |
ccgtgagcataactcagttggtaggataatgcattattatatgcaggggccggggttcgaacctcgaatactccacttattca |
33944378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 422 - 468
Target Start/End: Complemental strand, 37889666 - 37889620
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||| ||||||||||| |
|
|
| T |
37889666 |
tatatgcaggggtcggggttcgaaccccggacacctcacttattcac |
37889620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 424 - 462
Target Start/End: Complemental strand, 43627291 - 43627253
Alignment:
| Q |
424 |
tatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
43627291 |
tatgcaggggtcggggttcaaaccctggacactccactt |
43627253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 387 - 473
Target Start/End: Original strand, 53621200 - 53621284
Alignment:
| Q |
387 |
gtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttga |
473 |
Q |
| |
|
|||||||||| || ||||| |||||||||||||| ||||| || | ||| || ||||||||| ||||| ||||||||||||||||| |
|
|
| T |
53621200 |
gtgagcataattcagttgacagggacatgcattgttatataca-gagtcgggattcgaaccc-agacaccccacttattcaccttga |
53621284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 471
Target Start/End: Complemental strand, 53698049 - 53697991
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||| |||||| ||||||||| ||||| |
|
|
| T |
53698049 |
atgcattattatatgcaggggccggggttcgaaccccggacaccccacttatttacctt |
53697991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 422 - 479
Target Start/End: Complemental strand, 7768848 - 7768791
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaatga |
479 |
Q |
| |
|
||||||||| || | |||||||||||| |||||| |||||||||||| || ||||||| |
|
|
| T |
7768848 |
tatatgcagaggccggggttcgaaccccggacaccccacttattcactttaaaaatga |
7768791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 411 - 476
Target Start/End: Complemental strand, 21023422 - 21023358
Alignment:
| Q |
411 |
acatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||| ||||| | ||||| |||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
21023422 |
acatgcattgttatatcc-ggggttggggttcgaacccccgacaccccacttattcaccttgaaaa |
21023358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 422 - 471
Target Start/End: Complemental strand, 21765469 - 21765420
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||||||| || |||||||||| |||||| ||||||||||||||| |
|
|
| T |
21765469 |
tatatgcaggggccaaggttcgaacctcggacaccccacttattcacctt |
21765420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 387 - 460
Target Start/End: Original strand, 37728939 - 37729012
Alignment:
| Q |
387 |
gtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccac |
460 |
Q |
| |
|
||||||||| || |||| |||||| ||||||| |||||||||||||| ||||||||| | ||||||||||| |
|
|
| T |
37728939 |
gtgagcatagttcagttggtagggatatgcattattatatgcaggggtcgaggttcgaactccggacactccac |
37729012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 384 - 445
Target Start/End: Original strand, 39293518 - 39293579
Alignment:
| Q |
384 |
tccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaa |
445 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
39293518 |
tccgtgagcatagctcagttggtagggacatgcataattatatgcaggggttggggttcgaa |
39293579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 422 - 467
Target Start/End: Complemental strand, 43362228 - 43362183
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
||||| |||||||| |||||||||||| |||||| ||||||||||| |
|
|
| T |
43362228 |
tatattcaggggtcggggttcgaaccccggacaccccacttattca |
43362183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 422 - 471
Target Start/End: Original strand, 45350311 - 45350360
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||| |||| | |||||||||| |||||| ||||||||||||||| |
|
|
| T |
45350311 |
tatatgcagaggtcggagttcgaaccccggacaccccacttattcacctt |
45350360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 422 - 471
Target Start/End: Original strand, 45359790 - 45359839
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||| |||| | |||||||||| |||||| ||||||||||||||| |
|
|
| T |
45359790 |
tatatgcagaggtcggagttcgaaccccggacaccccacttattcacctt |
45359839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 422 - 471
Target Start/End: Complemental strand, 49280729 - 49280680
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||||||||| | ||| ||||||||||||| |||||||||||||| |
|
|
| T |
49280729 |
tatatgcaggggtcggtgtttgaaccctggacacctcacttattcacctt |
49280680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 407 - 476
Target Start/End: Original strand, 49743382 - 49743451
Alignment:
| Q |
407 |
agggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||| ||||||| |||||||||||| | || ||||||||| |||||| |||||||| |||||||||| |
|
|
| T |
49743382 |
agggatatgcattattatatgcaggggccgggattcgaaccccggacacctcacttatttaccttgaaaa |
49743451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 422 - 471
Target Start/End: Original strand, 56555583 - 56555632
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||||||||| ||||||||||| | |||| ||||||||||||||| |
|
|
| T |
56555583 |
tatatgcaggggtcggggttcgaacctcgaacaccccacttattcacctt |
56555632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 194709 - 194669
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
194709 |
tatatgcaggggttggggttcgaaccccggacactccactt |
194669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 4958588 - 4958548
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
4958588 |
tatatgcaggagtcggggttcgaaccccggacactccactt |
4958548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 12289731 - 12289683
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcagggg |
433 |
Q |
| |
|
||||||||||||||| ||||||||| | |||||||| |||||| ||||| |
|
|
| T |
12289731 |
ccgtgagcataactcagttgataggaatatgcattgttatatgtagggg |
12289683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 392 - 476
Target Start/End: Complemental strand, 12585649 - 12585565
Alignment:
| Q |
392 |
cataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||| |||| |||||||||||||| |||||| | ||| | | |||||||||| | |||| |||||||||| |||||||| |
|
|
| T |
12585649 |
cataactcagttggcagggacatgcattgttatatgtaagggccggagttcgaaccccgaacacctcacttattcatcttgaaaa |
12585565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 13578497 - 13578457
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||| |||||| |
|
|
| T |
13578497 |
tatatgcaggggtcggggttcgaaccccggacaccccactt |
13578457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 438 - 478
Target Start/End: Original strand, 13976277 - 13976317
Alignment:
| Q |
438 |
ggttcgaaccctggacactccacttattcaccttgaaaatg |
478 |
Q |
| |
|
||||||||||||| ||||||||||||||||| || |||||| |
|
|
| T |
13976277 |
ggttcgaaccctgaacactccacttattcacatttaaaatg |
13976317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 15604072 - 15604032
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| || ||||||||| ||||||||||||| |
|
|
| T |
15604072 |
tatatgcaggggtcgggattcgaaccccggacactccactt |
15604032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 17617012 - 17616972
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
17617012 |
tatatgcaggggccggggttcgaaccccggacactccactt |
17616972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 18360531 - 18360571
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
18360531 |
tatatgcaggggccggggttcgaaccccggacactccactt |
18360571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 28715728 - 28715768
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
28715728 |
tatatgcaggggccggggttcgaaccccggacactccactt |
28715768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 34040466 - 34040506
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||| |||||||||||||||||| | ||||||||||||| |
|
|
| T |
34040466 |
tatatgtaggggtcagggttcgaactccggacactccactt |
34040506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 34353817 - 34353857
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||| |||||| |
|
|
| T |
34353817 |
tatatgcagaggtcagggttcgaaccccggacaccccactt |
34353857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 36132267 - 36132307
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
36132267 |
tatatgcaggagtcggggttcgaaccccggacactccactt |
36132307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 36602398 - 36602358
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
36602398 |
tatatgcaggggccggggttcgaaccccggacactccactt |
36602358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 424 - 468
Target Start/End: Original strand, 40486481 - 40486525
Alignment:
| Q |
424 |
tatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
|||||||||| | |||||||||||| ||||||||||||| ||||| |
|
|
| T |
40486481 |
tatgcaggggccggggttcgaaccccggacactccacttcttcac |
40486525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 47890733 - 47890773
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
47890733 |
tatatgcaggggtcggggttcgaaccccagacactccactt |
47890773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 47934104 - 47934064
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
47934104 |
tatatgcaggggccggggttcgaaccccggacactccactt |
47934064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 48950822 - 48950862
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
48950822 |
tatatgcaggagtcggggttcgaaccccggacactccactt |
48950862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 49757316 - 49757276
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||| | | |||||||||||||||||||||||||| |
|
|
| T |
49757316 |
tatatgcaggagccggggttcgaaccctggacactccactt |
49757276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 55021592 - 55021632
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||| ||||| |
|
|
| T |
55021592 |
tatatgcaggggtcggggttcgaaccccggacacttcactt |
55021632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 431 - 475
Target Start/End: Original strand, 55677149 - 55677193
Alignment:
| Q |
431 |
gggtcagggttcgaaccctggacactccacttattcaccttgaaa |
475 |
Q |
| |
|
||||| |||||||||| | ||||||||||||||||||| |||||| |
|
|
| T |
55677149 |
gggtcggggttcgaactccggacactccacttattcactttgaaa |
55677193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 52; Significance: 1e-20; HSPs: 73)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 385 - 471
Target Start/End: Original strand, 11133073 - 11133160
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| ||| |||| |||||||| ||||||| |||||||||||||| |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
11133073 |
ccgtgagcatagctcagttggtagggacaatgcattgttatatgcaggggtcggggttcgaaccccggacaccccacttattcacctt |
11133160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 386 - 476
Target Start/End: Original strand, 1244568 - 1244658
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||| || |||| |||||||| ||||||||||||||||||| |||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
1244568 |
cgtgagcatagttcagttggcagggacatacattgctatatgcaggggtgggggttcgaaccccggacaccccacttattcaccttgaaaa |
1244658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 386 - 482
Target Start/End: Complemental strand, 29896257 - 29896161
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaatgatga |
482 |
Q |
| |
|
||||| |||| ||| ||||| || ||||||||||| |||||||| | ||||||||||||| | ||||||| |||||||||||||||||||| ||||| |
|
|
| T |
29896257 |
cgtgaacatatctcagttgacagtgacatgcattgttatatgcatgagtcagggttcgaatcatggacaccccacttattcaccttgaaaaagatga |
29896161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 406 - 476
Target Start/End: Original strand, 36413779 - 36413849
Alignment:
| Q |
406 |
tagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||||||| |||||||||||| | | ||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
36413779 |
tagggacatgcattgttatatgcaggggccggagttcgaaccctggacaccccacttattcactttgaaaa |
36413849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 468
Target Start/End: Complemental strand, 14307792 - 14307708
Alignment:
| Q |
384 |
tccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| ||| |||| ||||||||||||||| |||||||||||||| ||||||||||| | |||| |||||||||||| |
|
|
| T |
14307792 |
tccgtgagcatggctcagttggtagggacatgcattgttatatgcaggggtcgaggttcgaaccccgaacaccccacttattcac |
14307708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 385 - 471
Target Start/End: Original strand, 10262737 - 10262823
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||||||| |||| |||| ||||||| |||||||||||||| |||||||||||| ||||| ||||||||||||||| |
|
|
| T |
10262737 |
ccgtgagcataactcagttggtaggacaatgcattattatatgcaggggtcggggttcgaaccccagacaccccacttattcacctt |
10262823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 385 - 471
Target Start/End: Original strand, 17154647 - 17154733
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||||||| |||| |||| ||||||| |||||||||||| | |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
17154647 |
ccgtgagcataactcggttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcacctt |
17154733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 422 - 476
Target Start/End: Original strand, 23405234 - 23405288
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
23405234 |
tatatgcaggggtcggggttcgaaccctggacaccccacttattcaccttaaaaa |
23405288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 44487864 - 44487773
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||| ||| ||| ||||||||||||||||||| |||||||| ||| | | |||||||||| ||||| ||||||||||||||| |||| |
|
|
| T |
44487864 |
ccgtgagtatagctcagttgatagggacatgcattattatatgcaagggccggagttcgaaccccggacatcccacttattcaccttaaaaa |
44487773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 385 - 471
Target Start/End: Complemental strand, 580880 - 580794
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| ||| |||| |||| ||||||| |||||||||||| | |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
580880 |
ccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcacctt |
580794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 381 - 455
Target Start/End: Complemental strand, 917392 - 917318
Alignment:
| Q |
381 |
gtttccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacac |
455 |
Q |
| |
|
|||||||||||| |||||| |||| ||| |||||||||| |||||||||||||| || ||||||||||| |||| |
|
|
| T |
917392 |
gtttccgtgagcttaactcagttggtagagacatgcattattatatgcaggggtcgggattcgaaccctgaacac |
917318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 413 - 471
Target Start/End: Complemental strand, 3037691 - 3037633
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||| |||||||||||| | |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
3037691 |
atgcattgttatatgcaggggccggggttcgaaccccggacaccccacttattcacctt |
3037633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 386 - 476
Target Start/End: Original strand, 39118392 - 39118482
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||| |||||| |||| ||||||||| ||||| |||||||||||| ||| ||||||| || | |||| |||||||||| |||| |||| |
|
|
| T |
39118392 |
cgtgagcgtaactcagttggtagggacatacattgttatatgcaggggccagagttcgaatcccgaacaccccacttattctccttaaaaa |
39118482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 410 - 482
Target Start/End: Original strand, 10602028 - 10602101
Alignment:
| Q |
410 |
gacatgcattgctatatgcaggggtcagggttcgaaccc-tggacactccacttattcaccttgaaaatgatga |
482 |
Q |
| |
|
||||||||||| |||||||||||| | |||||||||||| |||||| |||||||||||| ||||||| ||||| |
|
|
| T |
10602028 |
gacatgcattgttatatgcaggggacggggttcgaacccacggacaccccacttattcactttgaaaaagatga |
10602101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 422 - 467
Target Start/End: Complemental strand, 25783274 - 25783229
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
25783274 |
tatatgcaggggttagggttcgaaccctggacaccccacttattca |
25783229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 422 - 458
Target Start/End: Original strand, 2289648 - 2289684
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactcc |
458 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2289648 |
tatatgcaggggtcagggttcgaaccctggacactcc |
2289684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 386 - 466
Target Start/End: Original strand, 19352865 - 19352945
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattc |
466 |
Q |
| |
|
||||| |||||||| ||||| || ||||||||||| ||||||||| ||||||| || |||||| |||||| ||||| |||| |
|
|
| T |
19352865 |
cgtgaacataactcagttgacagagacatgcattgttatatgcagaggtcaggatttgaaccccggacacgccactcattc |
19352945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 413 - 468
Target Start/End: Complemental strand, 24034122 - 24034067
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
24034122 |
atgcattattatatgcaggggtcggggttcgaacctcggacactccacttattcac |
24034067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 32288374 - 32288465
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||| || ||| ||||| || ||||||||| |||||| |||| || ||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
32288374 |
ccgtgagcgtagctcagttgacagaaacatgcattattatatgtagggatcggggttcgaacctcggacaccccacttattcaccttgaaaa |
32288465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 386 - 469
Target Start/End: Original strand, 41699101 - 41699184
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacc |
469 |
Q |
| |
|
|||||||||||||| |||| |||| |||||| |||||||||||||| |||||||||||| | |||| ||||||||||||| |
|
|
| T |
41699101 |
cgtgagcataactcagttggtaggatattgcattattatatgcaggggtcggggttcgaaccccgaacaccccacttattcacc |
41699184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 413 - 467
Target Start/End: Original strand, 9796923 - 9796977
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||| |||||| ||||||||||| |
|
|
| T |
9796923 |
atgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattca |
9796977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 388 - 482
Target Start/End: Complemental strand, 36386207 - 36386114
Alignment:
| Q |
388 |
tgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaatgatga |
482 |
Q |
| |
|
|||||||| ||| |||| |||||| |||||||| |||||||||||||| ||||| ||| | |||||| |||||||||||| || |||| ||||| |
|
|
| T |
36386207 |
tgagcatagctcagttggtagggatatgcattgttatatgcaggggtc-gggtttgaatctcggacaccccacttattcactttaaaaaagatga |
36386114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 422 - 467
Target Start/End: Complemental strand, 15069831 - 15069786
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||| |||| |
|
|
| T |
15069831 |
tatatgcaggggtcggggttcgaaccccggacactccacttcttca |
15069786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 387 - 476
Target Start/End: Original strand, 18065254 - 18065343
Alignment:
| Q |
387 |
gtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||| ||| |||| ||| | ||||||||| ||||||||||||| ||||||||||| | |||| |||||||||||||||||| |
|
|
| T |
18065254 |
gtgagcatagctcagttggtagaggcatgcattgttatatgcaggggttgaggttcgaaccccgaacaccttacttattcaccttgaaaa |
18065343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 385 - 446
Target Start/End: Complemental strand, 37065531 - 37065470
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaac |
446 |
Q |
| |
|
||||||||||| ||| |||| || |||||||||||| ||||||||| |||| |||||||||| |
|
|
| T |
37065531 |
ccgtgagcatagctctgttggtatggacatgcattgttatatgcagtggtcggggttcgaac |
37065470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 381 - 466
Target Start/End: Original strand, 40471147 - 40471232
Alignment:
| Q |
381 |
gtttccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattc |
466 |
Q |
| |
|
||||||||| | ||||||| ||||| ||||||||||||| ||||||||||||| || |||||| || | |||| |||||||||| |
|
|
| T |
40471147 |
gtttccgtgggtataactcagttgacagggacatgcattattatatgcaggggttgggattcgaatcccgaacaccccacttattc |
40471232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 384 - 476
Target Start/End: Original strand, 18089726 - 18089818
Alignment:
| Q |
384 |
tccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||||| ||| |||| || |||||||||| |||||||||| ||| |||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
18089726 |
tccgtgagcatagctcagttggcagagacatgcattatactatgcaggggccagagttcgaaccccagacacctcacttattcaccttgaaaa |
18089818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 468
Target Start/End: Complemental strand, 21970537 - 21970453
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| ||| ||||| ||||||| |||||| ||||||||||| || |||||||||||| ||| || || ||||||||| |
|
|
| T |
21970537 |
ccgtgagcatagctcagttgacagggacaatgcattattatatgcagggatcggggttcgaaccccggataccccgcttattcac |
21970453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 384 - 448
Target Start/End: Complemental strand, 26807182 - 26807118
Alignment:
| Q |
384 |
tccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccc |
448 |
Q |
| |
|
|||||||||||||||| |||| |||| ||||||| |||||||||||| |||||||||||||| |
|
|
| T |
26807182 |
tccgtgagcataactcagttggtaggacaatgcattattatatgcaggggccagggttcgaaccc |
26807118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 28692517 - 28692477
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
28692517 |
tatatgcaggggtcggggttcgaacccaggacactccactt |
28692477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 468
Target Start/End: Original strand, 29034973 - 29035057
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| ||| ||| ||||||| |||||| |||||||||||| | |||||||||||| |||||| |||||||||||| |
|
|
| T |
29034973 |
ccgtgagcatagctcacttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
29035057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 469
Target Start/End: Complemental strand, 36520849 - 36520793
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacc |
469 |
Q |
| |
|
||||||| |||||| ||||||| |||||||||||| |||||| ||||||||||||| |
|
|
| T |
36520849 |
atgcattattatatgtaggggtcggggttcgaaccccggacaccccacttattcacc |
36520793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 422 - 474
Target Start/End: Original strand, 37912464 - 37912516
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaa |
474 |
Q |
| |
|
|||||| ||||||| |||||| ||||| |||||| |||||||||||||||||| |
|
|
| T |
37912464 |
tatatgtaggggtcggggttcaaaccccggacaccccacttattcaccttgaa |
37912516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 38525585 - 38525545
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
38525585 |
tatatgcaggggtcagggttcgaacccggaacactccactt |
38525545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 464
Target Start/End: Complemental strand, 38557292 - 38557213
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatg-cattgctatatgcaggggtcagggttcgaaccctggacactccacttat |
464 |
Q |
| |
|
|||||||| |||||| |||| |||||| ||| |||| |||||||||||||| |||||||||||| ||||||| ||||||| |
|
|
| T |
38557292 |
ccgtgagcttaactcagttggtagggatatggcattt-tatatgcaggggtcggggttcgaaccccggacacttcacttat |
38557213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 413 - 476
Target Start/End: Original strand, 9520834 - 9520897
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||| |||||| |||||| || |||||||||| | |||| ||||||||||||||| |||| |
|
|
| T |
9520834 |
atgcattgttatatgtaggggttagagttcgaaccccgaacaccccacttattcaccttaaaaa |
9520897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 467
Target Start/End: Original strand, 29664600 - 29664683
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
||||||||||| ||| ||| ||||||| ||||||| |||||||||||||| |||||| || || |||||| ||||||||||| |
|
|
| T |
29664600 |
ccgtgagcatagctcaattggcagggacaatgcattgttatatgcaggggtcggggttcaaatcccggacaccccacttattca |
29664683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 34107272 - 34107363
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||| |||| ||||||||| || ||||||||||||| ||||||||| | ||||| |||||||||||||||||||| |
|
|
| T |
34107272 |
ccgtgagcatagctcagttggcagggacatgtataattatatgcaggggttgaggttcgaactccagacaccccacttattcaccttgaaaa |
34107363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 436 - 471
Target Start/End: Complemental strand, 37886271 - 37886236
Alignment:
| Q |
436 |
agggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37886271 |
agggttcgaaccctggacaccccacttattcacctt |
37886236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 39334978 - 39334887
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||| ||||| |||||| |||||||||| | |||| |||||||||||| ||||||| |
|
|
| T |
39334978 |
ccgtgagcataactcagttggcagggacatgcattattatatacaggggctggggttcgaactccagacatcccacttattcactttgaaaa |
39334887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 413 - 468
Target Start/End: Original strand, 44187730 - 44187785
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||| ||||| |||||||||||| |
|
|
| T |
44187730 |
atgcattattatatgcaggggtcggggttcgaaccccagacaccccacttattcac |
44187785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 385 - 471
Target Start/End: Original strand, 3179322 - 3179408
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||||||| |||| ||| ||||||| |||||||||||||| |||||||||| ||||| ||||||||||||||| |
|
|
| T |
3179322 |
ccgtgagcataactcagttggtagaacaatgcattattatatgcaggggtcgaggttcgaacctcagacaccccacttattcacctt |
3179408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 410 - 476
Target Start/End: Complemental strand, 4529835 - 4529769
Alignment:
| Q |
410 |
gacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||| |||||||||||||| | |||||||| | | |||| |||||||||||| ||||||| |
|
|
| T |
4529835 |
gacatgcattattatatgcaggggtcggagttcgaactccgaacaccccacttattcactttgaaaa |
4529769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 385 - 471
Target Start/End: Original strand, 7086251 - 7086337
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| ||| |||| ||||| ||||||| |||||||||||| | || ||||||||| | |||| ||| ||||||||||| |
|
|
| T |
7086251 |
ccgtgagcatagctcagttggtagggcaatgcattattatatgcaggggccgggattcgaaccccgaacaccccaattattcacctt |
7086337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 385 - 471
Target Start/End: Complemental strand, 8234889 - 8234803
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| ||| |||| |||| || |||| |||||| ||||| | |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
8234889 |
ccgtgagcatagctcagttggtaggacaatacattattatatgtaggggccggggttcgaaccccggacaccccacttattcacctt |
8234803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 422 - 476
Target Start/End: Original strand, 12206533 - 12206587
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||| |||||||| |||||||||||| | |||| || ||||||||||||||||| |
|
|
| T |
12206533 |
tatattcaggggtcggggttcgaaccccgaacaccccgcttattcaccttgaaaa |
12206587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 467
Target Start/End: Complemental strand, 19052680 - 19052626
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||| ||||| ||||||||||| |
|
|
| T |
19052680 |
atgcattattatatgcaggggtcaggattcgaaccccggacatcccacttattca |
19052626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 471
Target Start/End: Complemental strand, 19905724 - 19905666
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||| ||||| |||||||| |||||||||||| |||||| | ||||||||||||| |
|
|
| T |
19905724 |
atgcattattatatacaggggtcggggttcgaaccccggacacccgacttattcacctt |
19905666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 385 - 467
Target Start/End: Complemental strand, 20122572 - 20122490
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
||||||||||| ||| |||| |||| ||||||| |||||| ||||| | |||||||||||| |||||| ||||||||||| |
|
|
| T |
20122572 |
ccgtgagcatagctcagttggtaggacaatgcattattatatgtaggggccggggttcgaaccccggacacgccacttattca |
20122490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 385 - 471
Target Start/End: Complemental strand, 30474292 - 30474206
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||| ||| |||| |||| ||||||| |||||||||||| | ||||||||||| ||||| ||||||||||||||| |
|
|
| T |
30474292 |
ccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccgaggttcgaaccccagacaccccacttattcacctt |
30474206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 467
Target Start/End: Original strand, 32891625 - 32891679
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||| |||| ||||||||||| |
|
|
| T |
32891625 |
atgcattattatatgcaggggttggggttcgaaccctgaacaccccacttattca |
32891679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 413 - 471
Target Start/End: Complemental strand, 44721773 - 44721715
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||| |||||| ||| ||||||||||| |
|
|
| T |
44721773 |
atgcattattatatgcaggggtcggggttcgaacctcggacaccccatttattcacctt |
44721715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 413 - 454
Target Start/End: Complemental strand, 2558327 - 2558286
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggaca |
454 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
2558327 |
atgcattattatatgtaggggtcagggttcgaaccctggaca |
2558286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 386 - 465
Target Start/End: Original strand, 9802892 - 9802970
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttatt |
465 |
Q |
| |
|
|||||||||| ||| |||||| ||||| |||||| |||||||| ||||| |||||||||||| |||||| ||||||||| |
|
|
| T |
9802892 |
cgtgagcatagctcagttgat--ggacaatgcattattatatgcaagggtcggggttcgaaccccggacaccccacttatt |
9802970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 422 - 471
Target Start/End: Original strand, 11837024 - 11837073
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||| ||||||| |||||||||||| |||||| |||||||||||||| |
|
|
| T |
11837024 |
tatatgtaggggtcggggttcgaaccccggacacctcacttattcacctt |
11837073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 413 - 462
Target Start/End: Original strand, 16261358 - 16261407
Alignment:
| Q |
413 |
atgcattgctatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||| ||||| |||||| |
|
|
| T |
16261358 |
atgcattgttatatgcaggggtcagagttcgaaccccagacaccccactt |
16261407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 422 - 471
Target Start/End: Original strand, 16973943 - 16973992
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||||| ||| ||||||||| |||||| ||||||||| ||||| |
|
|
| T |
16973943 |
tatatgcaggggttaggattcgaaccccggacaccccacttatttacctt |
16973992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 426 - 467
Target Start/End: Complemental strand, 19843419 - 19843378
Alignment:
| Q |
426 |
tgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
19843419 |
tgcaggggtcagggttcgaaccctagacacctcacttattca |
19843378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 386 - 471
Target Start/End: Complemental strand, 22297548 - 22297463
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
|||||||||| ||| |||| |||| ||||||| |||||||||||| |||||||||||| |||||| ||| ||||||||||| |
|
|
| T |
22297548 |
cgtgagcatagctcagttggtaggacaatgcattattatatgcaggggcaggggttcgaaccccggacaccccatttattcacctt |
22297463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 407 - 468
Target Start/End: Complemental strand, 26975373 - 26975313
Alignment:
| Q |
407 |
agggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||| |||||| ||| |||||||| |
|
|
| T |
26975373 |
agggacatgcattgctatatgcagaggctggggttcgaaccccggacac-ccagttattcac |
26975313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 425 - 462
Target Start/End: Complemental strand, 30871350 - 30871313
Alignment:
| Q |
425 |
atgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
30871350 |
atgcaggggtcagggttcgaatcccggacactccactt |
30871313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 3438986 - 3439026
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
3438986 |
tatatgcaggagtcggggttcgaaccccggacactccactt |
3439026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 5521252 - 5521212
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
5521252 |
tatatgcaggggccgaggttcgaaccctggacactccactt |
5521212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 383 - 471
Target Start/End: Original strand, 10207641 - 10207729
Alignment:
| Q |
383 |
ttccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcacctt |
471 |
Q |
| |
|
||||||||||||| ||| |||| |||| ||||||| ||||||||| |||| | ||| |||| | ||||||| |||||||||||||| |
|
|
| T |
10207641 |
ttccgtgagcatagctcagttggtaggataatgcattattatatgcagtggtcggagtttgaactccggacacttcacttattcacctt |
10207729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 11093820 - 11093780
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
11093820 |
tatatgcaggagtcggggttcgaaccccggacactccactt |
11093780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 407 - 475
Target Start/End: Complemental strand, 13294459 - 13294393
Alignment:
| Q |
407 |
agggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaa |
475 |
Q |
| |
|
|||||||||||||| ||||||||||| | | ||| |||||||| |||| |||||||||||| ||||||| |
|
|
| T |
13294459 |
agggacatgcattgttatatgcagggatga-ggtacgaaccctagaca-tccacttattcatcttgaaa |
13294393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 17777195 - 17777155
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||| |||||| |
|
|
| T |
17777195 |
tatatgcaggggtcggggttcgaaccccggacaccccactt |
17777155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 22653676 - 22653636
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
22653676 |
tatatgcaggagtcggggttcgaaccccggacactccactt |
22653636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 23984255 - 23984215
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||| |||||| |
|
|
| T |
23984255 |
tatatgcaggggccagggttcgaaccccggacaccccactt |
23984215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 27016315 - 27016355
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
||||| |||||||| | |||||||||||||||||||||||| |
|
|
| T |
27016315 |
tatatacaggggtcggagttcgaaccctggacactccactt |
27016355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Original strand, 33262480 - 33262520
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
33262480 |
tatatgcaggggtcggggttcgaacctcggacactccactt |
33262520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 40535481 - 40535441
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| | |||||||||||| ||||||||||||| |
|
|
| T |
40535481 |
tatatgcaggggccggggttcgaaccccggacactccactt |
40535441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 40688671 - 40688631
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||| |||| |
|
|
| T |
40688671 |
tatatgcaggggccagggttcgaaccccggacactctactt |
40688631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0178 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: scaffold0178
Description:
Target: scaffold0178; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 386 - 468
Target Start/End: Original strand, 4322 - 4404
Alignment:
| Q |
386 |
cgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
|||||||||| ||| ||||||||| || |||| |||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
4322 |
cgtgagcatagctcagttgataggacaatacattattatatgcaggggtcggggttcgaaccccggacactccacttattcac |
4404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 385 - 466
Target Start/End: Complemental strand, 34130 - 34049
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattc |
466 |
Q |
| |
|
||||||||||| ||| |||| |||||||||||||| |||||||||||| | ||||||||| | ||||||||||||||||| |
|
|
| T |
34130 |
ccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggccggggttcgaattccggacactccacttattc |
34049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0054 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 1)
Name: scaffold0054
Description:
Target: scaffold0054; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 388 - 476
Target Start/End: Original strand, 67162 - 67250
Alignment:
| Q |
388 |
tgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||| ||| |||| ||||| |||||||| |||||| ||||| ||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
67162 |
tgagcatagctcagttgggagggatatgcattgttatatgtaggggctggggttcgaaccctggacaccccacttaatcaccttgaaaa |
67250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 476
Target Start/End: Original strand, 1037 - 1128
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||| |||| ||||||||||||| |||||| ||||| |||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
1037 |
ccgtgagcatagctcagttggtagggacatgcataattatatgtaggggctggggttcgaaccccagacaccccacttattcaccttgaaaa |
1128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0118 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold0118
Description:
Target: scaffold0118; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 476
Target Start/End: Complemental strand, 37425 - 37334
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
||||||||||| ||| |||| ||||||||||||||| | ||| |||||| | ||||||| ||||||||| ||||||||||||||| |||| |
|
|
| T |
37425 |
ccgtgagcatagctcagttggtagggacatgcattgttttatacaggggccgatgttcgaaacctggacaccccacttattcaccttaaaaa |
37334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0129 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 1)
Name: scaffold0129
Description:
Target: scaffold0129; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 406 - 476
Target Start/End: Original strand, 7075 - 7145
Alignment:
| Q |
406 |
tagggacatgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||| |||||||| |||||||||||||||| |||||||| |
|
|
| T |
7075 |
tagggatatgcattgttatatgcaggggtcaggtttcgaacctcatacactccacttattcatcttgaaaa |
7145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0308 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0308
Description:
Target: scaffold0308; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 468
Target Start/End: Original strand, 7073 - 7157
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| ||| |||| |||||||| |||||| |||||||||||| | |||||||||||| |||||| ||| |||||||| |
|
|
| T |
7073 |
ccgtgagcatagctcagttgttagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccatttattcac |
7157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0112 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0112
Description:
Target: scaffold0112; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 468
Target Start/End: Complemental strand, 18029 - 17945
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| ||| ||| |||||||| ||||||| |||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
18029 |
ccgtgagcatagctcaattggtagggacaatgcattgttatatgcaggggctggggttcgaaccccagacactccacttattcac |
17945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0126 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0126
Description:
Target: scaffold0126; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 422 - 476
Target Start/End: Complemental strand, 22909 - 22856
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcaccttgaaaa |
476 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
22909 |
tatatgcaggggcc-gggttcgaaccctggacaccccacttattcaccttaaaaa |
22856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 384 - 437
Target Start/End: Original strand, 4517 - 4570
Alignment:
| Q |
384 |
tccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcag |
437 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||| |||||||||||||||| |
|
|
| T |
4517 |
tccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggtcag |
4570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 384 - 437
Target Start/End: Original strand, 4537 - 4590
Alignment:
| Q |
384 |
tccgtgagcataactccgttgatagggacatgcattgctatatgcaggggtcag |
437 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||| |||||||||||||||| |
|
|
| T |
4537 |
tccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggtcag |
4590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 467
Target Start/End: Original strand, 25023 - 25106
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattca |
467 |
Q |
| |
|
||||||||||| ||| |||| ||||||| |||||| |||||||||||| |||||||||||| |||||| ||||||||||| |
|
|
| T |
25023 |
ccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggctggggttcgaaccccggacaccccacttattca |
25106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0219 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 422 - 472
Target Start/End: Complemental strand, 6693 - 6643
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccacttattcaccttg |
472 |
Q |
| |
|
|||||||||||| | |||||||||||| |||||| ||| |||||||||||| |
|
|
| T |
6693 |
tatatgcaggggccggggttcgaaccccggacaccccaattattcaccttg |
6643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0070 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0070
Description:
Target: scaffold0070; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 387 - 468
Target Start/End: Original strand, 12564 - 12646
Alignment:
| Q |
387 |
gtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||| ||| |||| ||||||| |||||| |||||||||||||||||||||||||| ||| || ||| |||||||| |
|
|
| T |
12564 |
gtgagcatagctcagttggcagggacaatgcattattatatgcaggggtcagggttcgaacctcggataccccatttattcac |
12646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0809 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0809
Description:
Target: scaffold0809; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 385 - 468
Target Start/End: Complemental strand, 4903 - 4820
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggaca-tgcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
||||||||||| ||| |||| ||||||| |||||| |||||||||||| | ||||||||| || |||||| |||||||||||| |
|
|
| T |
4903 |
ccgtgagcatagctcagttggcagggacaatgcattattatatgcagggg-cggggttcgaatcccggacaccccacttattcac |
4820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0707 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0707
Description:
Target: scaffold0707; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 422 - 462
Target Start/End: Complemental strand, 52 - 12
Alignment:
| Q |
422 |
tatatgcaggggtcagggttcgaaccctggacactccactt |
462 |
Q |
| |
|
|||||||||| | | |||||||||||||||||||||||||| |
|
|
| T |
52 |
tatatgcaggagccggggttcgaaccctggacactccactt |
12 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0294 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0294
Description:
Target: scaffold0294; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 385 - 468
Target Start/End: Complemental strand, 17330 - 17247
Alignment:
| Q |
385 |
ccgtgagcataactccgttgatagggacat-gcattgctatatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
|||||| | |||||| ||||||||||| || ||||| || ||||||||| | |||||||||||| ||||||||||||| ||||| |
|
|
| T |
17330 |
ccgtgaacttaactcagttgatagggatattgcattt-tacatgcaggggccggggttcgaaccccggacactccacttcttcac |
17247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0246 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0246
Description:
Target: scaffold0246; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 424 - 468
Target Start/End: Original strand, 24420 - 24464
Alignment:
| Q |
424 |
tatgcaggggtcagggttcgaaccctggacactccacttattcac |
468 |
Q |
| |
|
|||||||||| | |||||||||||| ||||||||||||| ||||| |
|
|
| T |
24420 |
tatgcaggggccggggttcgaaccccggacactccacttcttcac |
24464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0034 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0034
Description:
Target: scaffold0034; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 423 - 455
Target Start/End: Original strand, 94690 - 94722
Alignment:
| Q |
423 |
atatgcaggggtcagggttcgaaccctggacac |
455 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
94690 |
atatgcaggggtcagggttcgaaccccggacac |
94722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 424 - 464
Target Start/End: Complemental strand, 236387 - 236347
Alignment:
| Q |
424 |
tatgcaggggtcagggttcgaaccctggacactccacttat |
464 |
Q |
| |
|
|||||||||||| |||||||||||| |||||| |||||||| |
|
|
| T |
236387 |
tatgcaggggtcggggttcgaaccccggacaccccacttat |
236347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University