View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2568_high_53 (Length: 243)
Name: NF2568_high_53
Description: NF2568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2568_high_53 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 21 - 232
Target Start/End: Complemental strand, 30877654 - 30877440
Alignment:
| Q |
21 |
atcataacttttgagtcattgtatttcaccatatatttttgacaatgacaaacaaccgttaaacaataaaaataattttgaaaaattgcaactttctgta |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30877654 |
atcataacttttgagtcattgtatttcaccatatatttttgacaatgacaaacaaccgttaaacaataaaaataattttgaaaaattgcaactttctgta |
30877555 |
T |
 |
| Q |
121 |
atctattttgtaattttcttcatctttatgnnnnnnnnc---gatagcaactactcttaggaaatcctcattcaacatataattttctcgttatctctca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30877554 |
atctattttgtaattttcttcatctttatgaaaaaaaccaaagatagcaactacttttaggaaatcctcattcaacatatcattttctcgttatctctca |
30877455 |
T |
 |
| Q |
218 |
aactcttcatctcac |
232 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
30877454 |
aactcttcatatcac |
30877440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University