View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2568_high_57 (Length: 236)
Name: NF2568_high_57
Description: NF2568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2568_high_57 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 98 - 212
Target Start/End: Complemental strand, 17494605 - 17494491
Alignment:
| Q |
98 |
ctatgatagctgatgactgataaataaatatgatgtgcaggaacttgaggaagtgggagggctagaagagctagagaaagagataagtaggaggacaaaa |
197 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17494605 |
ctatgataactgatgagtgataaataaatatgatgtgcaggaacttgaggaagtgggagggctagaagagctagagaaagagataagtaggaggacaaaa |
17494506 |
T |
|
| Q |
198 |
tcatacaataatagt |
212 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
17494505 |
tcatacaatagtagt |
17494491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 132 - 202
Target Start/End: Original strand, 45088309 - 45088379
Alignment:
| Q |
132 |
gtgcaggaacttgaggaagtgggagggctagaagagctagagaaagagataagtaggaggacaaaatcata |
202 |
Q |
| |
|
||||||||| |||| |||||||||||| ||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
45088309 |
gtgcaggaagttgaagaagtgggagggatagaagagctagagaaagagataagtaggagaacaagatcata |
45088379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University