View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2568_high_65 (Length: 223)
Name: NF2568_high_65
Description: NF2568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2568_high_65 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 13 - 207
Target Start/End: Original strand, 43864751 - 43864945
Alignment:
| Q |
13 |
gagatgaagccatcaaccggatgacaggttctagaagtaactaaaaaagtgtccaaaaatagtaatttgcaattttgaaaccaaatttctgtccaaaaca |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43864751 |
gagaagaagccatcaaccggatgacaggttctagaagtaactaaaaaagtgtccaaaaatagtaatttgcaattttgaaaccaaatttctgtccaaaaca |
43864850 |
T |
 |
| Q |
113 |
tggttagtattaaagggtggtgatatgatcatggagttttatttgatgtgttgtggaacacggtgttgcttacttaggtggatcgtggatccttc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43864851 |
tggttagtattaaagggtggtgatatgatcatggtgttttatttgatgtgttgtggaacacggtgttgcttacttaggtggatcgtggatccttc |
43864945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University