View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2568_high_65 (Length: 223)

Name: NF2568_high_65
Description: NF2568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2568_high_65
NF2568_high_65
[»] chr1 (1 HSPs)
chr1 (13-207)||(43864751-43864945)


Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 13 - 207
Target Start/End: Original strand, 43864751 - 43864945
Alignment:
13 gagatgaagccatcaaccggatgacaggttctagaagtaactaaaaaagtgtccaaaaatagtaatttgcaattttgaaaccaaatttctgtccaaaaca 112  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43864751 gagaagaagccatcaaccggatgacaggttctagaagtaactaaaaaagtgtccaaaaatagtaatttgcaattttgaaaccaaatttctgtccaaaaca 43864850  T
113 tggttagtattaaagggtggtgatatgatcatggagttttatttgatgtgttgtggaacacggtgttgcttacttaggtggatcgtggatccttc 207  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43864851 tggttagtattaaagggtggtgatatgatcatggtgttttatttgatgtgttgtggaacacggtgttgcttacttaggtggatcgtggatccttc 43864945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University