View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2568_low_25 (Length: 364)
Name: NF2568_low_25
Description: NF2568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2568_low_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 1 - 345
Target Start/End: Original strand, 41936945 - 41937289
Alignment:
| Q |
1 |
ttctcttgaaagcttgagatgtctactactgtgatccaaggtttgttggcattgttaactcgaaaattaaaatctaattgtattttatttgaacttgtac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41936945 |
ttctcttgaaagcttgagatgtctactactgtgatgcaaggtttgttggcattgttaactcgaaaattaaaatctaattgtattttatttgaacttgtac |
41937044 |
T |
|
| Q |
101 |
tggttcttaaaaagtttattatcatagttggatgggatgctgcaaggggaattgttgcatgaaataaagcagtagacacttggaatggattccgaaggta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41937045 |
tggttcttaaaaagtttattatcatagttggatgggatgctgcaaggggaattggcgcatgaaataaagcagtagacacttggagtggattccgaaggta |
41937144 |
T |
|
| Q |
201 |
gtttgaggattcaaaaggatctgctaaattctatggatgtagattttgagatgctgagagatttttgagtactttgcattgattgcagaagtttcgacgt |
300 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41937145 |
gtttgaggattccaaaggatctgctaaattctatggatgtagattttgagatgctgagggatttttgagtactttgcattgattgcagaagtttcgacgt |
41937244 |
T |
|
| Q |
301 |
ccttaattttgcatgttggtatggaatttgaccatggtggtaatg |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41937245 |
ccttaattttgcatgttggtatggaatttgaccatggtggtaatg |
41937289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University