View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2568_low_35 (Length: 323)
Name: NF2568_low_35
Description: NF2568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2568_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 5e-87; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 5e-87
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 7154165 - 7153975
Alignment:
| Q |
1 |
atatattttgtttgtcttaaatgtatttttctttttgtcctagttgttacagccaaatggatgacgatgaagctatttttctcnnnnnnnnaagcaactc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7154165 |
atatattttgtttgtcttaaatgtatttttctttttgtcctagttgttacagccaaatggatgacgatgaagctatttttctctttttttgaagcaactc |
7154066 |
T |
 |
| Q |
101 |
tgaggctatttcttatagagtctaggattcgaatcagggtcaccacatctccctccatgtgcgtttatttgcgtatgtgtggatcattagg |
191 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7154065 |
tgaggctatttcttgtagagtctaggattcgaatcagggtcaccacatctccctccatgtgcgtttatttgcgtatgtgtggatcattagg |
7153975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 241 - 308
Target Start/End: Complemental strand, 7153925 - 7153858
Alignment:
| Q |
241 |
atctcgattaccccttatatatgttttaaaatcgacaagtttttacaattcatgtgtatgatggattt |
308 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7153925 |
atctcgaataccccttatatatattttaaaatcgacaagtttttacaattcatgtgtatgatggattt |
7153858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University