View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2568_low_45 (Length: 261)
Name: NF2568_low_45
Description: NF2568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2568_low_45 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 11 - 248
Target Start/End: Original strand, 34305859 - 34306091
Alignment:
| Q |
11 |
cacagacatatgatagacaataattgtatgtgtttccttttctctttttagatgttgccactttatttagctcttgtctttggtgtattggttagaagta |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34305859 |
cacagacatatgatagacaataattgtatgtgtttccttttctctctttagatgttgccactttatttagctcttgtctttggtgtattggttagaagta |
34305958 |
T |
|
| Q |
111 |
cttgtagtgcttccannnnnnnccacacacatatcatatcatatcatatatgctataaaaaagctgtattgctcattccataattccaaccctcttttga |
210 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34305959 |
cttgtagtgcttccatttttttccacaca-----catatcatatcatatatgctataaaaaagctgtattgctcattccataattccaaccctcttttgg |
34306053 |
T |
|
| Q |
211 |
tttttgatgcctttggacattcacttgggtacattttg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34306054 |
tttttgatgcctttggacattcacttgggtacattttg |
34306091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University