View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2568_low_46 (Length: 259)

Name: NF2568_low_46
Description: NF2568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2568_low_46
NF2568_low_46
[»] chr7 (1 HSPs)
chr7 (17-61)||(25325792-25325836)


Alignment Details
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 17 - 61
Target Start/End: Complemental strand, 25325836 - 25325792
Alignment:
17 attctagacaatgttataggagacaagcaaatcgagttgttcaaa 61  Q
    |||||||||||||||||||||||||||||||| ||||||||||||    
25325836 attctagacaatgttataggagacaagcaaattgagttgttcaaa 25325792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University