View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2568_low_46 (Length: 259)
Name: NF2568_low_46
Description: NF2568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2568_low_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 17 - 61
Target Start/End: Complemental strand, 25325836 - 25325792
Alignment:
| Q |
17 |
attctagacaatgttataggagacaagcaaatcgagttgttcaaa |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25325836 |
attctagacaatgttataggagacaagcaaattgagttgttcaaa |
25325792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University