View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2568_low_56 (Length: 245)
Name: NF2568_low_56
Description: NF2568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2568_low_56 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 125 - 229
Target Start/End: Complemental strand, 41023418 - 41023315
Alignment:
| Q |
125 |
gaactttgtgataaaaacattaggaaaattaaatggagtctaagattaagactttagaagtgcttccatttataattatggtgattatggaagggtgcac |
224 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41023418 |
gaactttgtgataaaaacattaggaaaat-aaatggagtctaagattaagactttagaagtgcttccattcataattatggtgattatggaagggtgcac |
41023320 |
T |
 |
| Q |
225 |
catag |
229 |
Q |
| |
|
||||| |
|
|
| T |
41023319 |
catag |
41023315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 41023540 - 41023462
Alignment:
| Q |
1 |
cttattcaagctccaacaattgaggagcaccacaccaagaaacacatagctagcatatatactcaaattaattctctgtcc |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41023540 |
cttattcaagctccaacaattgaggagcaccacaccaagaaacacatagctagca--tatactcaaattaattctctgtcc |
41023462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University