View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2568_low_58 (Length: 244)
Name: NF2568_low_58
Description: NF2568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2568_low_58 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 37808313 - 37808085
Alignment:
| Q |
1 |
cattgtcaaatttattgcaatgttatttaagatggggataatataatatgttgaaatgcttttaatcaaatttatcctaaaaaactcatggacgtgtagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37808313 |
cattgtcaaatttattgcaatgttatttaagatggggataatataatatgttgaaatgcttttaatcaaatttatcctaaaaaactcatggacgtgtagg |
37808214 |
T |
|
| Q |
101 |
ttaattgttggcatgtgtgtgcctttttatcaactatttgaatataaaaagatataaaaaatagagtgatttgataggtttat-gat-atacacacaaat |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| |||||||| |
|
|
| T |
37808213 |
ttaattgttggcatgtgtgtgcctttttatcaactatttgaatataaaaagatataaaaaatagagtgatttgataggtttatatatgatatacacaaat |
37808114 |
T |
|
| Q |
199 |
tgaatggatacattagagagaaagagatg |
227 |
Q |
| |
|
|||||| |||||||||||||||||||||| |
|
|
| T |
37808113 |
tgaatgcatacattagagagaaagagatg |
37808085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 193
Target Start/End: Complemental strand, 37808078 - 37808043
Alignment:
| Q |
158 |
aaaatagagtgatttgataggtttatgatatacaca |
193 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37808078 |
aaaatagagtgatttaataggtttatgatatacaca |
37808043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University