View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2568_low_63 (Length: 237)

Name: NF2568_low_63
Description: NF2568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2568_low_63
NF2568_low_63
[»] chr8 (2 HSPs)
chr8 (115-216)||(8392587-8392688)
chr8 (1-35)||(8392480-8392514)


Alignment Details
Target: chr8 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 115 - 216
Target Start/End: Original strand, 8392587 - 8392688
Alignment:
115 gtttgaacaacattaataagtgaaaataattggatctgacaacagagaaaatccccatcgttcttaccatacagtctgattaaatatttgagaatacaaa 214  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
8392587 gtttgaaaaacattaataagtgaaaataattggatctgacaacagagaaaatccccatcgttcttaccaaacagtctgattaaatatttgagaatacaaa 8392686  T
215 ta 216  Q
    ||    
8392687 ta 8392688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 8392480 - 8392514
Alignment:
1 tttcctccgtgatgcctttcatgcatgtgcaatca 35  Q
    |||||||||||||| ||||||||||||||||||||    
8392480 tttcctccgtgatggctttcatgcatgtgcaatca 8392514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University