View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2568_low_64 (Length: 237)
Name: NF2568_low_64
Description: NF2568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2568_low_64 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 168
Target Start/End: Complemental strand, 41023941 - 41023774
Alignment:
| Q |
1 |
atggtagggccagaaataatgtgtgccactaaaccatttacaaacatactaaaaagcctcaagttattggtccttgatgattcatttcttattctaaggt |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41023941 |
atggtagggccacaaataatgtgtgccactaaaccatttacaaacatactaaaaagcctcaagttattggtccttgatgattcatttcttattctaaggt |
41023842 |
T |
 |
| Q |
101 |
taaatcactacagtgtatacatataataaccaacaaataaatagagaacatgtgcacaatatctatac |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
41023841 |
aaaatcactacagtgtatacatataataaccaacaaataaatagagaacatgtgcacaagatttatac |
41023774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 204 - 237
Target Start/End: Complemental strand, 41023740 - 41023707
Alignment:
| Q |
204 |
atgatgtcatgttttggtcaattgtttaattaat |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
41023740 |
atgatgtcatgttttggtcaattgtttaattaat |
41023707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University