View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2569_low_10 (Length: 221)
Name: NF2569_low_10
Description: NF2569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2569_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 18 - 209
Target Start/End: Complemental strand, 23168396 - 23168205
Alignment:
| Q |
18 |
cttttcgccacttttggacctgaactaggcgctttccttccaaatgattatgaggaggcatgtaaagaaagaccttttgaaggaaccgggcttgctatgc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
23168396 |
cttttcgccacttttggacctgaactaggcgctttccttccaaatgattctgaggaggcatgtaaagacagaccttttgaaggaaccgggcttgctatgc |
23168297 |
T |
|
| Q |
118 |
ttcgatacaaagagaataagcctatccaagatttgttttctgaggccttcaatgtctttctaaactgcgatgtctttatgccttcctttgct |
209 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
23168296 |
ttcgatacaaagagaataagcatatccaagatttgttttctgaggccttcaatgtctttctaaactgcgatgtctttatgctttcctttgct |
23168205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 18 - 212
Target Start/End: Original strand, 14658522 - 14658716
Alignment:
| Q |
18 |
cttttcgccacttttggacctgaactaggcgctttccttccaaatgattatgaggaggcatgtaaagaaagaccttttgaaggaaccgggcttgctatgc |
117 |
Q |
| |
|
||||| |||||| |||||||||||||||||| |||||||||||| |||| |||||||||||||||||| | || |||||||||| ||||||||||||||| |
|
|
| T |
14658522 |
ctttttgccactattggacctgaactaggcgttttccttccaaaagattctgaggaggcatgtaaagacatacattttgaaggagccgggcttgctatgc |
14658621 |
T |
|
| Q |
118 |
ttcgatacaaagagaataagcctatccaagatttgttttctgaggccttcaatgtctttctaaactgcgatgtctttatgccttcctttgcttct |
212 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
14658622 |
ttcgatacaaagagaataagcctagccaagatttgttttctgaggccttcaatgtctttctaaactgtgatgtcttaatgccttcctttgcttct |
14658716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 19 - 209
Target Start/End: Original strand, 25105862 - 25106051
Alignment:
| Q |
19 |
ttttcgccacttttggacctgaactaggcgctttccttccaaatgattatgaggaggcatgtaaagaaagaccttttgaaggaaccgggcttgctatgct |
118 |
Q |
| |
|
|||| ||||||||||||| |||| |||||| ||||||||||| |||| ||| ||||||||| |||| ||||||| ||||| | |||||||||||||| |
|
|
| T |
25105862 |
tttttgccacttttggacatgaatgaggcgccttccttccaaaagattctgatgaggcatgtgaagatggacctttcaaaggagc-gggcttgctatgct |
25105960 |
T |
|
| Q |
119 |
tcgatacaaagagaataagcctatccaagatttgttttctgaggccttcaatgtctttctaaactgcgatgtctttatgccttcctttgct |
209 |
Q |
| |
|
| ||||||| || ||| ||| |||||||||||||||||||||||||||| | |||||| | ||| |||| ||||||||||| |||||| |
|
|
| T |
25105961 |
ccaatacaaaaaggatagaccttgccaagatttgttttctgaggccttcaatttttttctagattgcaatgtttttatgccttcttttgct |
25106051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University