View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2569_low_4 (Length: 307)
Name: NF2569_low_4
Description: NF2569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2569_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 16 - 292
Target Start/End: Original strand, 9147266 - 9147542
Alignment:
| Q |
16 |
ggtgggatccaaactcagatatcttatcttggtcttctggcagggtctttagggttggagaccaaatatgtatgtctctttctttaccaannnnnnnnnn |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9147266 |
ggtgggatccaaactcagatatcttatcttggtcttctggcagggtctttagggttggagaccaaatatgtatgtctctttctttaccaatttttatttt |
9147365 |
T |
|
| Q |
116 |
nnnnnngttaattcttcttctattttcatgagtcctttcataaaatatgctcttttatttattgttatttttctcacaagagctagattcaaaatggaat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9147366 |
tattttgttaattcttcttctattttcatgagtcctttcataaaatatgctcttttatttattgttatttttctcacaagagctagattcaaaatggaat |
9147465 |
T |
|
| Q |
216 |
ggttgggggaaaatgatatatttgttttatagaaaaaatttaggatgagaaatggtttaaggctaggcagagagaac |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9147466 |
ggttgggggaaaatgatatatttgttttatagaaaaaatttaggatgagaaatggtttaaggctaggcagagagaac |
9147542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University