View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2570_high_5 (Length: 268)
Name: NF2570_high_5
Description: NF2570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2570_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 32 - 222
Target Start/End: Original strand, 1332833 - 1333023
Alignment:
| Q |
32 |
agatacatgcaatcagaacctaacacttataggttaatagcacacaaattagttgcaaaatggatcaatgtggtaatgacatcgtaaacaaataaaaata |
131 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1332833 |
agatacatgcaatcagaacctaacactaataggctaatagcacacaaattagttgcaaaatggatcaatgtggtaatgacatcgtaaacaaataaaaata |
1332932 |
T |
 |
| Q |
132 |
ggtaagcaaatactagatacttttctgtgaccattaaaattttagttcaagccactaattctagcggttgcaagttggaagcaaataaaat |
222 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1332933 |
ggtaagcaaatactagatacttttctatgaccattaaaattttagttcaagccactaattctagcggttgcaagttggaagcaaataaaat |
1333023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University