View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2570_high_8 (Length: 212)
Name: NF2570_high_8
Description: NF2570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2570_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 107 - 194
Target Start/End: Original strand, 39793431 - 39793518
Alignment:
| Q |
107 |
ctctccctgcaacaggtttgtttctacttcccacaaaaatgggactgagcacaactaaagatcccatcatacgaagtggtagtttgcc |
194 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
39793431 |
ctctccctgcaacaggtttgtttctactttccacaaaaatgggactgagcacaactaaagataccatcatacgaagtggtaggttgcc |
39793518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University