View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2570_low_12 (Length: 289)
Name: NF2570_low_12
Description: NF2570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2570_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 62 - 249
Target Start/End: Original strand, 47678643 - 47678833
Alignment:
| Q |
62 |
ttcacattgcaacaacatcaaacgcgtgtcatcaacgtcctccactactattgttaaaataaagtgtgctcgtaaaaacactcannnnnnn-aacaacac |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
47678643 |
ttcacattgcaacaacatcaaacgcgtgtcatcaacgtcctccactactattgttaaaatagagtgtgctcgtaaaaacactcattttttttaacaacac |
47678742 |
T |
 |
| Q |
161 |
--tgcatgctgaacagggaaatataagcacattatgctcttaatagcatataattcctgttcgggatttctgccattaattatctctgctc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47678743 |
agtgcatgctgaacagggaaatataagcacattatgctcttaatagcatataattcctgttcgggatttctgccattaattatgtctgctc |
47678833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University