View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2571_low_11 (Length: 268)

Name: NF2571_low_11
Description: NF2571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2571_low_11
NF2571_low_11
[»] chr1 (2 HSPs)
chr1 (9-87)||(4254824-4254902)
chr1 (115-163)||(4254928-4254976)


Alignment Details
Target: chr1 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 9 - 87
Target Start/End: Original strand, 4254824 - 4254902
Alignment:
9 gattatactagatgaataaataaggtgttcagagtttgaagattaacccttacatattagaatacattgtctctgccaa 87  Q
    ||||||||||||||||||||||||||||||||||||| || || |||||||||||||||||||||||||||| ||||||    
4254824 gattatactagatgaataaataaggtgttcagagtttaaaaatcaacccttacatattagaatacattgtctgtgccaa 4254902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 115 - 163
Target Start/End: Original strand, 4254928 - 4254976
Alignment:
115 atctatgaattatttttcatttccgaatgattttctaacgtgtaagctc 163  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
4254928 atctatgaattatttttcatttccgaatgattttctaacgtgtaagctc 4254976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University