View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2572_low_4 (Length: 340)
Name: NF2572_low_4
Description: NF2572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2572_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 38 - 179
Target Start/End: Complemental strand, 34051158 - 34051017
Alignment:
| Q |
38 |
atggaagatggcattgttataaagggtctgtatgtgtgaagagataggggatagttgatacaactaccccaacgaacttttaattgttatatgtgtgggc |
137 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34051158 |
atggaagatggcattgttataaagggtttgtatgtgtgaagagataggggatagttgatacaactaccccaacgaacttttaattgtaatatgtgtgggc |
34051059 |
T |
 |
| Q |
138 |
attgaattagccaactgggaaacagccttataaattatatat |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34051058 |
attgaattagccaactgggaaacagccttataaattttatat |
34051017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 277 - 324
Target Start/End: Complemental strand, 34050918 - 34050871
Alignment:
| Q |
277 |
tggatacaacaagtacaatactgaaatagcacatgcatgcatgttaat |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34050918 |
tggatacaacaagtacaatactgaaatagcacatgcatgcatgttaat |
34050871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University