View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2573_low_9 (Length: 245)
Name: NF2573_low_9
Description: NF2573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2573_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 47 - 199
Target Start/End: Original strand, 30284447 - 30284603
Alignment:
| Q |
47 |
caaaaggtacactttaagaacatatgggtactatggcccacgttcactttataaaagcaaatgaggagctgtgaatgagtggaatgaaatctgtgttata |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| ||| ||||||||||||||||||||||| |
|
|
| T |
30284447 |
caaaaggtacactttaagaacatatgggtactatggcccacgtccactttataaaagcaaatgagaagctgtaaataagtggaatgaaatctgtgttata |
30284546 |
T |
|
| Q |
147 |
aaga---aaaggtggaatgaaatttgactt-aatacttcgaatatgcatgattcatc |
199 |
Q |
| |
|
|||| ||| || |||||||||||||||| || |||||||||||||||||| |||| |
|
|
| T |
30284547 |
aagaaagaaaagttgaatgaaatttgacttgaagacttcgaatatgcatgatgcatc |
30284603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University