View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2574_high_12 (Length: 250)
Name: NF2574_high_12
Description: NF2574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2574_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 12 - 232
Target Start/End: Original strand, 19330214 - 19330431
Alignment:
| Q |
12 |
atgaatacagttgctttgtttacatgtgcttagtgacggatctaaaaaatttatgttgcggagataataatacatgtattaaaaagttgtggaaaaaata |
111 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19330214 |
atgaatacggttgctttgtttacatgtgcttagtgacggatctaaaaaatttatgttgcggagataa---tacatgtattaaaaagttgtggaaaaaata |
19330310 |
T |
 |
| Q |
112 |
ctcatctgtggattattttgtttcacttcatttttctcatttattttctccacaaatttcatgtatctttcactactcaggaattctttgtcgaagctgg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19330311 |
atcatctgtggattattttgtttcacttcatttttctcatttattttctccacaaatttcatgtatctttcactactcaggaattctttgttgaagctgg |
19330410 |
T |
 |
| Q |
212 |
attagtgttttcagttagttc |
232 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
19330411 |
attagtgttttcagttagttc |
19330431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University